RchiOBHm_Chr1g0372361

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
61099645 .. 61100372
728 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59635

Sequence Viewer

Length: 255 bp
ATGGGGAAGCATCCAAGATGTTGTTGTGGAGATGATGGTGATCAATCCCCTATTAACAACGGAGAAAGAAGTAGGCGTAATCGGAAAAGAGCATCATCATTGTGTCATTGTCCTGCAGTTTCTTCAATATTTAGAAGGATAGGAAGATGTATGTTTGTGACTTGTTTCCCTGTCATACAATGTTTTGGATTAGATGAATGTAGACACCACCACCACCATCACCATCACCATAAACATTTTGCCGAGTTTACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.78

Weight (kDa)

9.04

Isoelectric Point (pI)

70.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018877)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g25980
prunus_persica Prupe.6G294500_v2.0.a1 Prupe.6G294500_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0372361
rosa_laevigata RLG00000026904
rosa_roxburghii Rroxscaffold_4G00285010
rosa_rugosa Rorug01G0371300
rosa_samantha Rh1CG356900 Rh1DG374600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 202
AgsI TTSAA 1 cut(s) 126
AsuHPI GGTGA 3 cut(s) 50, 212, 218
BccI CCATC 3 cut(s) 29, 225, 231
BclI TGATCA 1 cut(s) 40
BfmI CTRYAG 1 cut(s) 114
BmsI GCATC 2 cut(s) 19, 101
BsaBI GATNNNNATC 1 cut(s) 39
Bse8I GATNNNNATC 1 cut(s) 39
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 40
BspMAI CTGCAG 1 cut(s) 118
BssMI GATC 1 cut(s) 40
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 114
BtsCI GGATG 1 cut(s) 10
CviAII CATG 1 cut(s) 252
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
FaeI CATG 1 cut(s) 255
FaiI YATR 4 cut(s) 152, 176, 231, 253
FatI CATG 1 cut(s) 251
FbaI TGATCA 1 cut(s) 40
FblI GTMKAC 1 cut(s) 202
Hin1II CATG 1 cut(s) 255
HphI GGTGA 3 cut(s) 50, 212, 218
Hpy166II GTNNAC 2 cut(s) 203, 249
Hpy188I TCNGA 1 cut(s) 84
Hpy8I GTNNAC 2 cut(s) 203, 249
HpyAV CCTTC 1 cut(s) 129
HpyCH4V TGCA 1 cut(s) 116
Hsp92II CATG 1 cut(s) 255
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 2 cut(s) 126, 183
LweI GCATC 2 cut(s) 19, 101
MaeIII GTNAC 1 cut(s) 157
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 2 cut(s) 114, 156
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 1 cut(s) 100
NdeII GATC 1 cut(s) 40
NlaIII CATG 1 cut(s) 255
NmuCI GTSAC 1 cut(s) 157
PstI CTGCAG 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 100
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 40
SfaNI GCATC 2 cut(s) 19, 101
SfcI CTRYAG 1 cut(s) 114
SgeI CNNG 4 cut(s) 27, 125, 174, 182
SmiMI CAYNNNNRTG 1 cut(s) 100
SspI AATATT 1 cut(s) 129
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 1 cut(s) 210
TspGWI ACGGA 1 cut(s) 75
XmiI GTMKAC 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.