Rroxscaffold_4G00285010

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
6476846 .. 6477633
788 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00285010.1

Sequence Viewer

Length: 249 bp
ATGGGGAAGCATCCAAGATGTCGTTGTGGAGATGATGGTGATCAATCCCCTATTAACAATGGAGAAAGAGGTAGGCGTAATCGGAAAAGAGCATCATCATTGTGTCATTGTCCTGCAGTTTCTTCAATATTTAGAAGGATAGGAAGATGTATGTTTGTGACTTGTTTCCCTGTCATACAATGTTTTGGATTAGATGAATGTAGACACCACCACCACCATCACCATAAACATTTTGCAGAGTTTACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.52

Weight (kDa)

9.33

Isoelectric Point (pI)

63.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018877)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g25980
prunus_persica Prupe.6G294500_v2.0.a1 Prupe.6G294500_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0372361
rosa_laevigata RLG00000026904
rosa_roxburghii Rroxscaffold_4G00285010
rosa_rugosa Rorug01G0371300
rosa_samantha Rh1CG356900 Rh1DG374600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 202
AgsI TTSAA 1 cut(s) 126
AsuHPI GGTGA 2 cut(s) 50, 212
BccI CCATC 2 cut(s) 29, 225
BclI TGATCA 1 cut(s) 40
BfmI CTRYAG 1 cut(s) 114
BmsI GCATC 2 cut(s) 19, 101
BsaBI GATNNNNATC 1 cut(s) 39
Bse8I GATNNNNATC 1 cut(s) 39
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 40
BspMAI CTGCAG 1 cut(s) 118
BssMI GATC 1 cut(s) 40
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 114
BtsCI GGATG 1 cut(s) 10
CviAII CATG 1 cut(s) 246
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
FaeI CATG 1 cut(s) 249
FaiI YATR 4 cut(s) 152, 176, 225, 247
FatI CATG 1 cut(s) 245
FbaI TGATCA 1 cut(s) 40
FblI GTMKAC 1 cut(s) 202
Hin1II CATG 1 cut(s) 249
HphI GGTGA 2 cut(s) 50, 212
Hpy166II GTNNAC 2 cut(s) 203, 243
Hpy188I TCNGA 1 cut(s) 84
Hpy8I GTNNAC 2 cut(s) 203, 243
HpyAV CCTTC 1 cut(s) 129
HpyCH4V TGCA 2 cut(s) 116, 236
Hsp92II CATG 1 cut(s) 249
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 2 cut(s) 126, 183
LweI GCATC 2 cut(s) 19, 101
MaeIII GTNAC 1 cut(s) 157
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 2 cut(s) 114, 156
MnlI CCTC 1 cut(s) 62
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 1 cut(s) 100
NdeII GATC 1 cut(s) 40
NlaIII CATG 1 cut(s) 249
NmuCI GTSAC 1 cut(s) 157
PstI CTGCAG 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 100
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 40
SetI ASST 1 cut(s) 73
SfaNI GCATC 2 cut(s) 19, 101
SfcI CTRYAG 1 cut(s) 114
SgeI CNNG 4 cut(s) 27, 125, 174, 182
SmiMI CAYNNNNRTG 1 cut(s) 100
SspI AATATT 1 cut(s) 129
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseFI GTSAC 1 cut(s) 157
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 1 cut(s) 210
XmiI GTMKAC 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.