RchiOBHm_Chr2g0121761

RRP12-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
34658533 .. 34668536
10004 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49422

Sequence Viewer

Length: 174 bp
ATGGGTTTATGCCTATCAACTCTAATCAAGATCCCCAATTTCATCAATGTGAAATTGGAATTCATAGAGGTTGCCGAAGGCCTAGCTTGTGGAACTCCTCATATGATCAGTGCTACGATTGATGGCCTTGCTCTGTTGGCTTATGAGTTTTCTGACCTTGTTTTCAACTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.16

Weight (kDa)

4.35

Isoelectric Point (pI)

17.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020515)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0121761
rosa_multiflora Rmu_sc0003140.1_g000015
rosa_roxburghii Rroxscaffold_4G00296880
rosa_samantha Rh3AG061800 Rh3BG063600 Rh3CG062500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 25
AcsI RAATTY 1 cut(s) 59
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
AlwI GGATC 1 cut(s) 25
AoxI GGCC 2 cut(s) 79, 124
ApoI RAATTY 1 cut(s) 59
BccI CCATC 1 cut(s) 116
BclI TGATCA 1 cut(s) 105
BfaI CTAG 2 cut(s) 83, 172
BseRI GAGGAG 1 cut(s) 87
BshFI GGCC 2 cut(s) 81, 126
BsnI GGCC 2 cut(s) 81, 126
Bsp143I GATC 2 cut(s) 30, 105
BspANI GGCC 2 cut(s) 81, 126
BspPI GGATC 1 cut(s) 25
BssMI GATC 2 cut(s) 30, 105
BstKTI GATC 2 cut(s) 33, 108
BstMBI GATC 2 cut(s) 30, 105
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstX2I RGATCY 1 cut(s) 30
BstYI RGATCY 1 cut(s) 30
BsuRI GGCC 2 cut(s) 81, 126
BtsIMutI CAGTG 1 cut(s) 115
CviJI RGCY 4 cut(s) 81, 86, 126, 140
CviKI_1 RGCY 4 cut(s) 81, 86, 126, 140
DpnI GATC 2 cut(s) 32, 107
DpnII GATC 2 cut(s) 30, 105
Eco147I AGGCCT 1 cut(s) 81
EcoRI GAATTC 1 cut(s) 59
FaiI YATR 5 cut(s) 10, 65, 102, 104, 144
FauNDI CATATG 1 cut(s) 102
FbaI TGATCA 1 cut(s) 105
FspBI CTAG 2 cut(s) 83, 172
HaeIII GGCC 2 cut(s) 81, 126
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 28
HpyAV CCTTC 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 2 cut(s) 30, 105
MaeI CTAG 2 cut(s) 83, 172
MalI GATC 2 cut(s) 32, 107
MboI GATC 2 cut(s) 30, 105
MflI RGATCY 1 cut(s) 30
MluCI AATT 3 cut(s) 37, 53, 59
MnlI CCTC 2 cut(s) 61, 108
MslI CAYNNNNRTG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeI CATATG 1 cut(s) 102
NdeII GATC 2 cut(s) 30, 105
PceI AGGCCT 1 cut(s) 81
PsuI RGATCY 1 cut(s) 30
RseI CAYNNNNRTG 1 cut(s) 47
Sau3AI GATC 2 cut(s) 30, 105
SetI ASST 3 cut(s) 72, 88, 159
SgeI CNNG 5 cut(s) 40, 95, 99, 140, 170
SmiMI CAYNNNNRTG 1 cut(s) 47
Sse9I AATT 3 cut(s) 37, 53, 59
SseBI AGGCCT 1 cut(s) 81
SspMI CTAG 2 cut(s) 83, 172
StuI AGGCCT 1 cut(s) 81
TasI AATT 3 cut(s) 37, 53, 59
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 2 cut(s) 31, 52
TspRI CASTG 1 cut(s) 115
XapI RAATTY 1 cut(s) 59
XspI CTAG 2 cut(s) 83, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.