Rroxscaffold_4G00296880

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
16893362 .. 16894089
728 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00296880.1

Sequence Viewer

Length: 201 bp
ATGCTGGAAATTATATTGGTTTCATCTTTTCCCTTGCTTTTTAATTACCTTGTTTTGGTTGTTAGTGAGGTAGTGGGTGGATTCAATGTGAAGGTCATAGGATGCGAATGCCCAACATGTGGAACTCCTCGTATGATCGGTGCGACAATTGATGGCCTTGCTCGATTGGCTTATGAGTTTCGACCTTGTTTCAACTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.2

Weight (kDa)

5.0

Isoelectric Point (pI)

29.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020515)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0121761
rosa_multiflora Rmu_sc0003140.1_g000015
rosa_roxburghii Rroxscaffold_4G00296880
rosa_samantha Rh3AG061800 Rh3BG063600 Rh3CG062500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 119
AfiI CCNNNNNNNGG 2 cut(s) 55, 119
AflIII ACRYGT 1 cut(s) 116
AgsI TTSAA 2 cut(s) 85, 193
AoxI GGCC 1 cut(s) 154
BccI CCATC 1 cut(s) 146
BfaI CTAG 1 cut(s) 199
BmsI GCATC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 119
BseGI GGATG 1 cut(s) 107
BseLI CCNNNNNNNGG 2 cut(s) 55, 119
BseRI GAGGAG 1 cut(s) 117
BshFI GGCC 1 cut(s) 156
BslI CCNNNNNNNGG 2 cut(s) 55, 119
BsmI GAATGC 1 cut(s) 113
BsnI GGCC 1 cut(s) 156
Bsp143I GATC 1 cut(s) 135
BspANI GGCC 1 cut(s) 156
BssMI GATC 1 cut(s) 135
BstF5I GGATG 1 cut(s) 107
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNSI RCATGY 1 cut(s) 120
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 107
CviAII CATG 1 cut(s) 117
CviJI RGCY 2 cut(s) 156, 170
CviKI_1 RGCY 2 cut(s) 156, 170
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
FaeI CATG 1 cut(s) 120
FaiI YATR 5 cut(s) 14, 98, 118, 134, 174
FatI CATG 1 cut(s) 116
FokI GGATG 1 cut(s) 114
FspBI CTAG 1 cut(s) 199
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 1 cut(s) 120
HinfI GANTC 1 cut(s) 81
HpyAV CCTTC 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
Hsp92II CATG 1 cut(s) 120
Kzo9I GATC 1 cut(s) 135
LweI GCATC 1 cut(s) 92
MaeI CTAG 1 cut(s) 199
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MfeI CAATTG 1 cut(s) 147
MluCI AATT 3 cut(s) 9, 43, 147
MnlI CCTC 2 cut(s) 61, 138
MseI TTAA 1 cut(s) 42
MunI CAATTG 1 cut(s) 147
Mva1269I GAATGC 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 1 cut(s) 135
NlaIII CATG 1 cut(s) 120
NspI RCATGY 1 cut(s) 120
PciI ACATGT 1 cut(s) 116
PctI GAATGC 1 cut(s) 113
PfeI GAWTC 1 cut(s) 81
PflMI CCANNNNNTGG 1 cut(s) 119
PscI ACATGT 1 cut(s) 116
SaqAI TTAA 1 cut(s) 42
Sau3AI GATC 1 cut(s) 135
SetI ASST 4 cut(s) 51, 72, 96, 187
SfaNI GCATC 1 cut(s) 92
SgeI CNNG 7 cut(s) 17, 46, 62, 129, 141, 170, 174
Sse9I AATT 3 cut(s) 9, 43, 147
SspMI CTAG 1 cut(s) 199
TaqI TCGA 2 cut(s) 163, 181
TasI AATT 3 cut(s) 9, 43, 147
TfiI GAWTC 1 cut(s) 81
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 12
Van91I CCANNNNNTGG 1 cut(s) 119
XceI RCATGY 1 cut(s) 120
XspI CTAG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.