RchiOBHm_Chr2g0123001

Flavin containing amine oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
36145396 .. 36145762
367 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49534

Sequence Viewer

Length: 228 bp
ATGTTTTTCACTTGTTATTGGTATCCCTACAGGAATATATTCAGCCTTGTTGATGAGCTGGAGATTAAACCCTTCACTAACTGGACTAAGTTTGCACAATATTCAGCTGAGGGATTGGAGGCTTTGAGATGTGTTAACACTGGCAAGAATGTTCTGCAGGTTGAATTTCTGGTATTTCGAGACCCTCCTCAATTGCCAACTCCATTAGGAACCTCATACTATTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.86

Weight (kDa)

5.14

Isoelectric Point (pI)

19.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020504)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 148
AcsI RAATTY 1 cut(s) 164
AgsI TTSAA 1 cut(s) 164
AluBI AGCT 2 cut(s) 58, 107
AluI AGCT 2 cut(s) 58, 107
Alw26I GTCTC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 164
Asp700I GAANNNNTTC 1 cut(s) 38
BbvCI CCTCAGC 1 cut(s) 108
BciVI GTATCC 1 cut(s) 33
BcoDI GTCTC 1 cut(s) 174
BfmI CTRYAG 2 cut(s) 28, 155
BfuAI ACCTGC 1 cut(s) 148
BfuI GTATCC 1 cut(s) 33
BmiI GGNNCC 1 cut(s) 211
BpmI CTGGAG 1 cut(s) 80
Bpu10I CCTNAGC 1 cut(s) 108
BsaI GGTCTC 1 cut(s) 174
Bse1I ACTGG 2 cut(s) 86, 145
BseMII CTCAG 1 cut(s) 99
BseNI ACTGG 2 cut(s) 86, 145
BseRI GAGGAG 1 cut(s) 177
BsmAI GTCTC 1 cut(s) 174
Bso31I GGTCTC 1 cut(s) 174
BspCNI CTCAG 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 211
BspMAI CTGCAG 1 cut(s) 159
BspMI ACCTGC 1 cut(s) 148
BspTNI GGTCTC 1 cut(s) 174
BsrI ACTGG 2 cut(s) 86, 145
BstDEI CTNAG 2 cut(s) 87, 108
BstMAI GTCTC 1 cut(s) 174
BstSFI CTRYAG 2 cut(s) 28, 155
BsuI GTATCC 1 cut(s) 33
BtsIMutI CAGTG 1 cut(s) 138
BveI ACCTGC 1 cut(s) 148
CviJI RGCY 4 cut(s) 45, 58, 107, 122
CviKI_1 RGCY 4 cut(s) 45, 58, 107, 122
DdeI CTNAG 2 cut(s) 87, 108
Eco31I GGTCTC 1 cut(s) 174
FaiI YATR 3 cut(s) 38, 217, 226
GsuI CTGGAG 1 cut(s) 80
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
HpaI GTTAAC 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 82
HpyCH4V TGCA 2 cut(s) 95, 157
HpyF3I CTNAG 2 cut(s) 87, 108
KspAI GTTAAC 1 cut(s) 136
LpnPI CCDG 6 cut(s) 16, 44, 67, 126, 143, 155
MfeI CAATTG 1 cut(s) 191
MluCI AATT 2 cut(s) 164, 191
MnlI CCTC 5 cut(s) 103, 112, 195, 198, 223
MroXI GAANNNNTTC 1 cut(s) 38
MseI TTAA 2 cut(s) 66, 135
MspA1I CMGCKG 1 cut(s) 107
MunI CAATTG 1 cut(s) 191
NlaIV GGNNCC 1 cut(s) 211
PdmI GAANNNNTTC 1 cut(s) 38
PspN4I GGNNCC 1 cut(s) 211
PstI CTGCAG 1 cut(s) 159
PvuII CAGCTG 1 cut(s) 107
SaqAI TTAA 2 cut(s) 66, 135
SetI ASST 4 cut(s) 60, 109, 162, 215
SfcI CTRYAG 2 cut(s) 28, 155
Sse9I AATT 2 cut(s) 164, 191
SspI AATATT 1 cut(s) 101
TaqI TCGA 1 cut(s) 178
TasI AATT 2 cut(s) 164, 191
Tru1I TTAA 2 cut(s) 66, 135
Tru9I TTAA 2 cut(s) 66, 135
TscAI CASTG 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 213
TspRI CASTG 1 cut(s) 145
XapI RAATTY 1 cut(s) 164
XmnI GAANNNNTTC 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.