RchiOBHm_Chr2g0141161

Heterogeneous nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
58724568 .. 58727923
3356 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51149

Sequence Viewer

Length: 126 bp
ATGCATCGAGAAATTGGGTTTATTACCTTTGAAAATGCAGACTTCGTGGAAAATTTAATGGCTGATACCCATGAATTGGGGGGTTCCAATGTAGTTGTTGATCGAGCAACACCCAAGGTCATCTAA

Protein Analysis

41

Amino Acids

4.57

Weight (kDa)

4.69

Isoelectric Point (pI)

20.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 76
AcsI RAATTY 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 1 cut(s) 32
ApoI RAATTY 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 85
BmsI GCATC 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 114
Bsc4I CCNNNNNNNGG 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 76
Bsp143I GATC 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 1 cut(s) 100
BssT1I CCWWGG 1 cut(s) 114
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
CviAII CATG 1 cut(s) 71
CviJI RGCY 1 cut(s) 62
CviKI_1 RGCY 1 cut(s) 62
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
Eco130I CCWWGG 1 cut(s) 114
EcoT14I CCWWGG 1 cut(s) 114
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 74
FaiI YATR 1 cut(s) 72
FatI CATG 1 cut(s) 70
Hin1II CATG 1 cut(s) 74
Hpy188III TCNNGA 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 4, 38
Hsp92II CATG 1 cut(s) 74
Kzo9I GATC 1 cut(s) 100
LweI GCATC 1 cut(s) 13
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MluCI AATT 3 cut(s) 12, 52, 74
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 56
NdeII GATC 1 cut(s) 100
NlaIII CATG 1 cut(s) 74
NlaIV GGNNCC 1 cut(s) 85
NsiI ATGCAT 1 cut(s) 6
PflMI CCANNNNNTGG 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 85
SaqAI TTAA 1 cut(s) 56
Sau3AI GATC 1 cut(s) 100
SetI ASST 2 cut(s) 29, 120
SfaNI GCATC 1 cut(s) 13
SgeI CNNG 4 cut(s) 20, 58, 83, 116
Sse9I AATT 3 cut(s) 12, 52, 74
StyI CCWWGG 1 cut(s) 114
TaqI TCGA 2 cut(s) 7, 103
TasI AATT 3 cut(s) 12, 52, 74
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 87
Van91I CCANNNNNTGG 1 cut(s) 76
XapI RAATTY 1 cut(s) 52
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.