RchiOBHm_Chr5g0044281

Heterogeneous nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
39601534 .. 39602113
580 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32249

Sequence Viewer

Length: 204 bp
ATGTACTCTACAATTCATTTATGTTTTCAAGTATTGTTGGATCAAGGCTCAAAAATGCATCGAGGAATTGGGTTTATTACCTTTGAAAATGCAGACTCCGTGGAAAATTTAATGGCCGATACCCATGAATTGGGGGGTTCCAATGTAGTTGTTGATCGAGCAACACCCAAGGCAAGGTACAGCATAACTGACCTTTACTTTTAG

Protein Analysis

67

Amino Acids

7.53

Weight (kDa)

5.35

Isoelectric Point (pI)

24.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 130
AclWI GGATC 1 cut(s) 48
AcoI YGGCCR 1 cut(s) 114
AcsI RAATTY 1 cut(s) 106
AfaI GTAC 2 cut(s) 5, 179
AfiI CCNNNNNNNGG 2 cut(s) 130, 174
AgsI TTSAA 2 cut(s) 29, 86
AlwI GGATC 1 cut(s) 48
AoxI GGCC 1 cut(s) 114
ApoI RAATTY 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 139
BmsI GCATC 1 cut(s) 67
BsaJI CCNNGG 2 cut(s) 99, 168
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 174
BseDI CCNNGG 2 cut(s) 99, 168
BseLI CCNNNNNNNGG 2 cut(s) 130, 174
BshFI GGCC 1 cut(s) 116
BslI CCNNNNNNNGG 2 cut(s) 130, 174
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 40, 154
BspANI GGCC 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 139
BspPI GGATC 1 cut(s) 48
BssECI CCNNGG 2 cut(s) 99, 168
BssMI GATC 2 cut(s) 40, 154
BssT1I CCWWGG 1 cut(s) 168
BstDSI CCRYGG 1 cut(s) 99
BstKTI GATC 2 cut(s) 43, 157
BstMBI GATC 2 cut(s) 40, 154
BsuRI GGCC 1 cut(s) 116
BtgI CCRYGG 1 cut(s) 99
Csp6I GTAC 2 cut(s) 4, 178
CviAII CATG 1 cut(s) 125
CviJI RGCY 2 cut(s) 48, 116
CviKI_1 RGCY 2 cut(s) 48, 116
CviQI GTAC 2 cut(s) 4, 178
DpnI GATC 2 cut(s) 42, 156
DpnII GATC 2 cut(s) 40, 154
EaeI YGGCCR 1 cut(s) 114
Eco130I CCWWGG 1 cut(s) 168
EcoT14I CCWWGG 1 cut(s) 168
EcoT22I ATGCAT 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 1 cut(s) 128
FaiI YATR 3 cut(s) 22, 126, 185
FatI CATG 1 cut(s) 124
HaeIII GGCC 1 cut(s) 116
Hin1II CATG 1 cut(s) 128
HinfI GANTC 1 cut(s) 95
HpyCH4V TGCA 2 cut(s) 58, 92
Hsp92II CATG 1 cut(s) 128
Kzo9I GATC 2 cut(s) 40, 154
LweI GCATC 1 cut(s) 67
MalI GATC 2 cut(s) 42, 156
MboI GATC 2 cut(s) 40, 154
MluCI AATT 4 cut(s) 12, 66, 106, 128
MlyI GAGTC 1 cut(s) 89
MmeI TCCRAC 1 cut(s) 18
MnlI CCTC 1 cut(s) 56
Mph1103I ATGCAT 1 cut(s) 60
MseI TTAA 1 cut(s) 110
NdeII GATC 2 cut(s) 40, 154
NlaIII CATG 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 139
NsiI ATGCAT 1 cut(s) 60
PflMI CCANNNNNTGG 1 cut(s) 130
PleI GAGTC 1 cut(s) 89
PpsI GAGTC 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 139
RsaI GTAC 2 cut(s) 5, 179
RsaNI GTAC 2 cut(s) 4, 178
SaqAI TTAA 1 cut(s) 110
Sau3AI GATC 2 cut(s) 40, 154
SchI GAGTC 1 cut(s) 89
SetI ASST 3 cut(s) 83, 179, 195
SfaNI GCATC 1 cut(s) 67
SgeI CNNG 8 cut(s) 41, 56, 74, 112, 137, 170, 181, 186
Sse9I AATT 4 cut(s) 12, 66, 106, 128
StyI CCWWGG 1 cut(s) 168
TaqI TCGA 2 cut(s) 61, 157
TasI AATT 4 cut(s) 12, 66, 106, 128
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TspDTI ATGAA 2 cut(s) 5, 141
TspGWI ACGGA 1 cut(s) 88
Van91I CCANNNNNTGG 1 cut(s) 130
XapI RAATTY 1 cut(s) 106
Zsp2I ATGCAT 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.