RchiOBHm_Chr2g0151411

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0019876
Physical Location & Seq
Forward (+)
69020813 .. 69021241
429 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52061

Sequence Viewer

Length: 243 bp
ATGCTGAATGTGAAACTTCGGCTATTTGTTCTTATTGCAAAGCAACCAGCCTTCCACCAGCTTAGATCAGTTGAGCAACTTGGTTACATAACTGCTCTTTTACAGAGGTTTGACACATTCAAATTACTAATCCAATTTATTATACAATCTGCAGTGAAGGGTCCAGGACATATTGATTTGAGAGTGGAGGAATTTCTCAAGACTTTTAAGAGTAAGCTTTATGAGATGACAAATTCAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

80

Amino Acids

9.38

Weight (kDa)

10.09

Isoelectric Point (pI)

42.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PqqF-like_C_4 PF22456 12 - 79 1.4e-12 PQQ synthase PqqF-like, C-terminal lobe domain 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019876)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0151411 RchiOBHm_Chr5g0063901
rosa_rugosa RorugMtG0004300.1 RorugMtG0004400.1
rosa_samantha Rh1BG009200 Rh1CG014200 Rh2BG499000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 191, 232
AgsI TTSAA 2 cut(s) 121, 237
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 2 cut(s) 61, 217
AluI AGCT 2 cut(s) 61, 217
ApoI RAATTY 2 cut(s) 191, 232
AspS9I GGNCC 1 cut(s) 161
AvaII GGWCC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 1 cut(s) 162
BmrFI CCNGG 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 182
BseBI CCWGG 1 cut(s) 165
Bsp143I GATC 1 cut(s) 65
BspLI GGNNCC 1 cut(s) 162
BspMAI CTGCAG 1 cut(s) 154
BssMI GATC 1 cut(s) 65
Bst2UI CCWGG 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 62
BstKTI GATC 1 cut(s) 68
BstMBI GATC 1 cut(s) 65
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BstSFI CTRYAG 1 cut(s) 150
BtsI GCAGTG 1 cut(s) 159
BtsIMutI CAGTG 1 cut(s) 159
Cfr13I GGNCC 1 cut(s) 161
CviJI RGCY 4 cut(s) 22, 50, 61, 217
CviKI_1 RGCY 4 cut(s) 22, 50, 61, 217
DdeI CTNAG 1 cut(s) 62
DpnI GATC 1 cut(s) 67
DpnII GATC 1 cut(s) 65
Eco47I GGWCC 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 163
FaiI YATR 4 cut(s) 89, 143, 171, 222
HindIII AAGCTT 1 cut(s) 215
Hpy188III TCNNGA 1 cut(s) 199
HpyAV CCTTC 2 cut(s) 61, 151
HpyCH4V TGCA 2 cut(s) 38, 152
HpyF3I CTNAG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 65
LpnPI CCDG 4 cut(s) 60, 71, 150, 177
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 67
MboI GATC 1 cut(s) 65
MluCI AATT 4 cut(s) 122, 134, 191, 232
MnlI CCTC 2 cut(s) 99, 181
MseI TTAA 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
NdeII GATC 1 cut(s) 65
NlaIV GGNNCC 1 cut(s) 162
PfoI TCCNGGA 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 162
PspPI GGNCC 1 cut(s) 161
PstI CTGCAG 1 cut(s) 154
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 1 cut(s) 65
Sau96I GGNCC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 165
SetI ASST 4 cut(s) 63, 110, 219, 242
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 6 cut(s) 59, 70, 92, 176, 177, 211
SinI GGWCC 1 cut(s) 161
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
Sse9I AATT 4 cut(s) 122, 134, 191, 232
StyD4I CCNGG 1 cut(s) 163
TasI AATT 4 cut(s) 122, 134, 191, 232
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TscAI CASTG 1 cut(s) 159
TspRI CASTG 1 cut(s) 159
VpaK11BI GGWCC 1 cut(s) 161
XapI RAATTY 2 cut(s) 191, 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.