Rh1BG009200

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0019876
Physical Location & Seq
Reverse (-)
1073286 .. 1075350
2065 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG009200.1

Sequence Viewer

Length: 438 bp
ATGGTTTGTTCTTGTAATTTTTGGGTGTCATTTGAGCCAGAGCATATTGGCACTCAAATTGTTGCTTGTATTCTGGTCAAGGCACTGATGGCAATGCCTGCTCTCGATTTCAACCTTTGTCTCTTCCTAATTCCAGAAATAGTGGTTCATCGAGATGATTTTATGCTGAATGTGAAACTTCGGCTGTTTGTTCTTATTGCAAAGCAACCAGCCTTCCACCAGCTTAGATCAGTTGAGCAACTTGGTTACATAACTGCTCCAAGTTCATGCCATCTGCTTTTACAGAGGAATGATTGTGGTATCCGAGGACTGCAGTTTATTATACAATCCGCAGTGAAGGGTCCAGGACATATTGATTTGAGAGTGGAGGAATTTCTCAAGACTTTTGAGAGTAGGCTTTATGAGATGACAAATGACAAATTCAAGCTTCGGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

145

Amino Acids

16.71

Weight (kDa)

8.26

Isoelectric Point (pI)

60.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PqqF-like_C_4 PF22456 66 - 142 2.8e-13 PQQ synthase PqqF-like, C-terminal lobe domain 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019876)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0151411 RchiOBHm_Chr5g0063901
rosa_rugosa RorugMtG0004300.1 RorugMtG0004400.1
rosa_samantha Rh1BG009200 Rh1CG014200 Rh2BG499000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 330
AcsI RAATTY 2 cut(s) 371, 419
AgsI TTSAA 2 cut(s) 112, 424
AjnI CCWGG 1 cut(s) 343
AluBI AGCT 2 cut(s) 223, 427
AluI AGCT 2 cut(s) 223, 427
Alw26I GTCTC 1 cut(s) 125
ApoI RAATTY 2 cut(s) 371, 419
AspS9I GGNCC 1 cut(s) 341
AvaII GGWCC 1 cut(s) 341
BccI CCATC 2 cut(s) 82, 279
BciT130I CCWGG 1 cut(s) 345
BciVI GTATCC 1 cut(s) 311
BcoDI GTCTC 1 cut(s) 125
BfmI CTRYAG 1 cut(s) 311
BfuI GTATCC 1 cut(s) 311
Bme1390I CCNGG 1 cut(s) 345
Bme18I GGWCC 1 cut(s) 341
BmgT120I GGNCC 1 cut(s) 341
BmiI GGNNCC 1 cut(s) 342
BmrFI CCNGG 1 cut(s) 345
BpuEI CTTGAG 1 cut(s) 362
BsaJI CCNNGG 1 cut(s) 304
Bse3DI GCAATG 1 cut(s) 99
BseBI CCWGG 1 cut(s) 345
BseDI CCNNGG 1 cut(s) 304
BseMI GCAATG 1 cut(s) 99
BsmAI GTCTC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 227
BspACI CCGC 1 cut(s) 330
BspLI GGNNCC 1 cut(s) 342
BspMAI CTGCAG 1 cut(s) 315
BsrDI GCAATG 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 304
BssMI GATC 1 cut(s) 227
Bst2UI CCWGG 1 cut(s) 345
Bst6I CTCTTC 1 cut(s) 128
BstAPI GCANNNNNTGC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 224
BstKTI GATC 1 cut(s) 230
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 1 cut(s) 227
BstMWI GCNNNNNNNGC 2 cut(s) 89, 98
BstNI CCWGG 1 cut(s) 345
BstSCI CCNGG 1 cut(s) 343
BstSFI CTRYAG 1 cut(s) 311
BsuI GTATCC 1 cut(s) 311
BtsI GCAGTG 1 cut(s) 339
BtsIMutI CAGTG 2 cut(s) 83, 339
Cac8I GCNNGC 1 cut(s) 99
Cfr13I GGNCC 1 cut(s) 341
CviAII CATG 1 cut(s) 267
CviJI RGCY 6 cut(s) 37, 184, 212, 223, 397, 427
CviKI_1 RGCY 6 cut(s) 37, 184, 212, 223, 397, 427
DdeI CTNAG 1 cut(s) 224
DpnI GATC 1 cut(s) 229
DpnII GATC 1 cut(s) 227
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 341
EcoRII CCWGG 1 cut(s) 343
FaeI CATG 1 cut(s) 270
FaiI YATR 7 cut(s) 45, 164, 251, 268, 323, 351, 402
FatI CATG 1 cut(s) 266
Hin1II CATG 1 cut(s) 270
HindIII AAGCTT 1 cut(s) 425
Hpy188I TCNGA 2 cut(s) 305, 432
Hpy188III TCNNGA 4 cut(s) 104, 134, 152, 379
HpyAV CCTTC 2 cut(s) 223, 331
HpyCH4V TGCA 2 cut(s) 200, 313
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 98
HpyF3I CTNAG 1 cut(s) 224
Hsp92II CATG 1 cut(s) 270
Kzo9I GATC 1 cut(s) 227
LmnI GCTCC 1 cut(s) 262
LpnPI CCDG 8 cut(s) 51, 59, 111, 147, 222, 233, 330, 357
MaeIII GTNAC 1 cut(s) 245
MalI GATC 1 cut(s) 229
MboI GATC 1 cut(s) 227
MboII GAAGA 1 cut(s) 115
MluCI AATT 5 cut(s) 16, 57, 129, 371, 419
MnlI CCTC 3 cut(s) 279, 299, 361
MslI CAYNNNNRTG 1 cut(s) 153
MspR9I CCNGG 1 cut(s) 345
MvaI CCWGG 1 cut(s) 345
MwoI GCNNNNNNNGC 2 cut(s) 89, 98
NdeII GATC 1 cut(s) 227
NlaIII CATG 1 cut(s) 270
NlaIV GGNNCC 1 cut(s) 342
PfoI TCCNGGA 1 cut(s) 343
Psp6I CCWGG 1 cut(s) 343
PspGI CCWGG 1 cut(s) 343
PspN4I GGNNCC 1 cut(s) 342
PspPI GGNCC 1 cut(s) 341
PstI CTGCAG 1 cut(s) 315
RseI CAYNNNNRTG 1 cut(s) 153
Sau3AI GATC 1 cut(s) 227
Sau96I GGNCC 1 cut(s) 341
ScrFI CCNGG 1 cut(s) 345
SetI ASST 3 cut(s) 117, 225, 429
SfcI CTRYAG 1 cut(s) 311
SinI GGWCC 1 cut(s) 341
SmiMI CAYNNNNRTG 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 377
SmoI CTYRAG 1 cut(s) 377
Sse9I AATT 5 cut(s) 16, 57, 129, 371, 419
SsiI CCGC 1 cut(s) 330
StyD4I CCNGG 1 cut(s) 343
TaqI TCGA 2 cut(s) 105, 151
TasI AATT 5 cut(s) 16, 57, 129, 371, 419
TscAI CASTG 2 cut(s) 90, 339
TspDTI ATGAA 2 cut(s) 137, 255
TspRI CASTG 2 cut(s) 90, 339
VpaK11BI GGWCC 1 cut(s) 341
XapI RAATTY 2 cut(s) 371, 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.