Rh1CG014200

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0019876
Physical Location & Seq
Reverse (-)
2210136 .. 2224825
14690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG014200.1

Sequence Viewer

Length: 306 bp
ATGAACGTACAAGTTCATCGAGATGATTTTATGCTGAATGTGAAACTTCGGCTGTTTGTTCTTATTGCAAAGCAACCAGCCTTCCACCAGCTTAGATCAGTTGAGCAACTTGGTTACATAACTGCTCCAAGTTCATGCCATCTGCTTTTACAGAGGAATGATTGTGGTATCCGAGGACTGCAGTTTATTATACAATCCGCAGTGAAGGGTCCAGGACATATTGATTTGAGAGTGGAGGAATTTCTCAAGACTTTTGAGAGTAGGCTTTATGAGATGACAAATGACAAATTCAAGCTTCGGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

101

Amino Acids

11.83

Weight (kDa)

9.62

Isoelectric Point (pI)

58.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PqqF-like_C_4 PF22456 22 - 98 9.2e-14 PQQ synthase PqqF-like, C-terminal lobe domain 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019876)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0151411 RchiOBHm_Chr5g0063901
rosa_rugosa RorugMtG0004300.1 RorugMtG0004400.1
rosa_samantha Rh1BG009200 Rh1CG014200 Rh2BG499000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 198
AcsI RAATTY 2 cut(s) 239, 287
AfaI GTAC 1 cut(s) 9
AgsI TTSAA 1 cut(s) 292
AjnI CCWGG 1 cut(s) 211
AluBI AGCT 2 cut(s) 91, 295
AluI AGCT 2 cut(s) 91, 295
ApoI RAATTY 2 cut(s) 239, 287
AspS9I GGNCC 1 cut(s) 209
AvaII GGWCC 1 cut(s) 209
BccI CCATC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 213
BciVI GTATCC 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 179
BfuI GTATCC 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 213
Bme18I GGWCC 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 209
BmiI GGNNCC 1 cut(s) 210
BmrFI CCNGG 1 cut(s) 213
BpuEI CTTGAG 1 cut(s) 230
BsaJI CCNNGG 1 cut(s) 172
BseBI CCWGG 1 cut(s) 213
BseDI CCNNGG 1 cut(s) 172
Bsp143I GATC 1 cut(s) 95
BspACI CCGC 1 cut(s) 198
BspLI GGNNCC 1 cut(s) 210
BspMAI CTGCAG 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 213
BstDEI CTNAG 1 cut(s) 92
BstKTI GATC 1 cut(s) 98
BstMBI GATC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 213
BstSCI CCNGG 1 cut(s) 211
BstSFI CTRYAG 1 cut(s) 179
BsuI GTATCC 1 cut(s) 179
BtsI GCAGTG 1 cut(s) 207
BtsIMutI CAGTG 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 209
Csp6I GTAC 1 cut(s) 8
CviAII CATG 1 cut(s) 135
CviJI RGCY 5 cut(s) 52, 80, 91, 265, 295
CviKI_1 RGCY 5 cut(s) 52, 80, 91, 265, 295
CviQI GTAC 1 cut(s) 8
DdeI CTNAG 1 cut(s) 92
DpnI GATC 1 cut(s) 97
DpnII GATC 1 cut(s) 95
Eco47I GGWCC 1 cut(s) 209
EcoRII CCWGG 1 cut(s) 211
FaeI CATG 1 cut(s) 138
FaiI YATR 6 cut(s) 32, 119, 136, 191, 219, 270
FatI CATG 1 cut(s) 134
Hin1II CATG 1 cut(s) 138
HindIII AAGCTT 1 cut(s) 293
Hpy188I TCNGA 2 cut(s) 173, 300
Hpy188III TCNNGA 2 cut(s) 20, 247
HpyAV CCTTC 2 cut(s) 91, 199
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 2 cut(s) 68, 181
HpyF3I CTNAG 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 6
Hsp92II CATG 1 cut(s) 138
Kzo9I GATC 1 cut(s) 95
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 4 cut(s) 90, 101, 198, 225
MaeII ACGT 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 97
MboI GATC 1 cut(s) 95
MluCI AATT 2 cut(s) 239, 287
MnlI CCTC 3 cut(s) 147, 167, 229
MslI CAYNNNNRTG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 213
MvaI CCWGG 1 cut(s) 213
NdeII GATC 1 cut(s) 95
NlaIII CATG 1 cut(s) 138
NlaIV GGNNCC 1 cut(s) 210
PfoI TCCNGGA 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 211
PspGI CCWGG 1 cut(s) 211
PspN4I GGNNCC 1 cut(s) 210
PspPI GGNCC 1 cut(s) 209
PstI CTGCAG 1 cut(s) 183
RsaI GTAC 1 cut(s) 9
RsaNI GTAC 1 cut(s) 8
RseI CAYNNNNRTG 1 cut(s) 21
Sau3AI GATC 1 cut(s) 95
Sau96I GGNCC 1 cut(s) 209
ScrFI CCNGG 1 cut(s) 213
SetI ASST 3 cut(s) 9, 93, 297
SfcI CTRYAG 1 cut(s) 179
SinI GGWCC 1 cut(s) 209
SmiMI CAYNNNNRTG 1 cut(s) 21
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
Sse9I AATT 2 cut(s) 239, 287
SsiI CCGC 1 cut(s) 198
StyD4I CCNGG 1 cut(s) 211
TaiI ACGT 1 cut(s) 9
TaqI TCGA 1 cut(s) 19
TasI AATT 2 cut(s) 239, 287
TscAI CASTG 1 cut(s) 207
TspDTI ATGAA 3 cut(s) 5, 17, 123
TspRI CASTG 1 cut(s) 207
VpaK11BI GGWCC 1 cut(s) 209
XapI RAATTY 2 cut(s) 239, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.