Rh2BG499000

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0019876
Physical Location & Seq
Forward (+)
70502094 .. 70503076
983 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG499000.1

Sequence Viewer

Length: 318 bp
ATGGCAATGCCTGCTCACGATTTCAACCTTTGTCTCTTCCTAATTCCAGAAATAGTGGTTCATCGAGATGATTTAATGCTGAATGTGAAACTTCGGCTATTTGTTCTTATTGCAAAGCAACCAGCCTTCCACCAGCTTAGATCAGTTGAGCAACTTGGTTACATAACTGCTCTTTTACAGAGGTTTGACACATTCAAATTACTAATCCAATTTATTATACAATCTGCAGTGAAGGGTCCAGGACATATTGATTTGAGAGTGGAGGAATTTCTCAAGACTTTTAAGAGTAAGCTTTATGAGATGACAAATTCAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

105

Amino Acids

12.27

Weight (kDa)

9.25

Isoelectric Point (pI)

44.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PqqF-like_C_4 PF22456 37 - 104 3.4e-12 PQQ synthase PqqF-like, C-terminal lobe domain 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019876)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0151411 RchiOBHm_Chr5g0063901
rosa_rugosa RorugMtG0004300.1 RorugMtG0004400.1
rosa_samantha Rh1BG009200 Rh1CG014200 Rh2BG499000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 266, 307
AgsI TTSAA 3 cut(s) 25, 196, 312
AjnI CCWGG 1 cut(s) 238
AluBI AGCT 2 cut(s) 136, 292
AluI AGCT 2 cut(s) 136, 292
Alw26I GTCTC 1 cut(s) 38
ApoI RAATTY 2 cut(s) 266, 307
AspS9I GGNCC 1 cut(s) 236
AvaII GGWCC 1 cut(s) 236
BciT130I CCWGG 1 cut(s) 240
BcoDI GTCTC 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 225
Bme1390I CCNGG 1 cut(s) 240
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmiI GGNNCC 1 cut(s) 237
BmrFI CCNGG 1 cut(s) 240
BpuEI CTTGAG 1 cut(s) 257
Bse3DI GCAATG 1 cut(s) 12
BseBI CCWGG 1 cut(s) 240
BseMI GCAATG 1 cut(s) 12
BsmAI GTCTC 1 cut(s) 38
Bsp143I GATC 1 cut(s) 140
BspLI GGNNCC 1 cut(s) 237
BspMAI CTGCAG 1 cut(s) 229
BsrDI GCAATG 1 cut(s) 12
BssMI GATC 1 cut(s) 140
Bst2UI CCWGG 1 cut(s) 240
Bst6I CTCTTC 1 cut(s) 41
BstAPI GCANNNNNTGC 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 137
BstKTI GATC 1 cut(s) 143
BstMAI GTCTC 1 cut(s) 38
BstMBI GATC 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 240
BstSCI CCNGG 1 cut(s) 238
BstSFI CTRYAG 1 cut(s) 225
BtsI GCAGTG 1 cut(s) 234
BtsIMutI CAGTG 1 cut(s) 234
Cac8I GCNNGC 1 cut(s) 12
Cfr13I GGNCC 1 cut(s) 236
CviJI RGCY 4 cut(s) 97, 125, 136, 292
CviKI_1 RGCY 4 cut(s) 97, 125, 136, 292
DdeI CTNAG 1 cut(s) 137
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco47I GGWCC 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 238
FaiI YATR 4 cut(s) 164, 218, 246, 297
HindIII AAGCTT 1 cut(s) 290
Hpy188III TCNNGA 4 cut(s) 17, 47, 65, 274
HpyAV CCTTC 2 cut(s) 136, 226
HpyCH4V TGCA 2 cut(s) 113, 227
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 137
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 6 cut(s) 24, 60, 135, 146, 225, 252
MaeIII GTNAC 1 cut(s) 158
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 1 cut(s) 28
MluCI AATT 5 cut(s) 42, 197, 209, 266, 307
MnlI CCTC 2 cut(s) 174, 256
MseI TTAA 2 cut(s) 74, 282
MslI CAYNNNNRTG 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 240
MvaI CCWGG 1 cut(s) 240
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 140
NlaIV GGNNCC 1 cut(s) 237
PfoI TCCNGGA 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
PspN4I GGNNCC 1 cut(s) 237
PspPI GGNCC 1 cut(s) 236
PstI CTGCAG 1 cut(s) 229
RseI CAYNNNNRTG 1 cut(s) 66
SaqAI TTAA 2 cut(s) 74, 282
Sau3AI GATC 1 cut(s) 140
Sau96I GGNCC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 240
SetI ASST 5 cut(s) 30, 138, 185, 294, 317
SfcI CTRYAG 1 cut(s) 225
SinI GGWCC 1 cut(s) 236
SmiMI CAYNNNNRTG 1 cut(s) 66
SmlI CTYRAG 1 cut(s) 272
SmoI CTYRAG 1 cut(s) 272
Sse9I AATT 5 cut(s) 42, 197, 209, 266, 307
StyD4I CCNGG 1 cut(s) 238
TaqI TCGA 1 cut(s) 64
TasI AATT 5 cut(s) 42, 197, 209, 266, 307
Tru1I TTAA 2 cut(s) 74, 282
Tru9I TTAA 2 cut(s) 74, 282
TscAI CASTG 1 cut(s) 234
TspDTI ATGAA 1 cut(s) 50
TspRI CASTG 1 cut(s) 234
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 2 cut(s) 266, 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.