RchiOBHm_Chr5g0063901

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0019876
Physical Location & Seq
Reverse (-)
69715345 .. 69715733
389 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33997

Sequence Viewer

Length: 207 bp
ATGCTGAATGTGAAACTTCGGCTGTTTGTTCTTATTGCAAAGCAACCAGCCTTCCACCAGCTTAGATCAGTTGAGCAACTTGGTTACATAACTGCTCTTTTACAGAGGAATGATTGTGGTATCCGAGGACTACAGTTTATTATACAATCCGCAATGAAGGGTCCAGGACATATTGATTTGAGAGTGGAAGAATTTCTAGAATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

68

Amino Acids

7.83

Weight (kDa)

9.1

Isoelectric Point (pI)

58.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PqqF-like_C_4 PF22456 12 - 67 4e-12 PQQ synthase PqqF-like, C-terminal lobe domain 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019876)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0151411 RchiOBHm_Chr5g0063901
rosa_rugosa RorugMtG0004300.1 RorugMtG0004400.1
rosa_samantha Rh1BG009200 Rh1CG014200 Rh2BG499000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 150
AcsI RAATTY 2 cut(s) 191, 200
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
ApoI RAATTY 2 cut(s) 191, 200
Asp700I GAANNNNTTC 1 cut(s) 192
AspS9I GGNCC 1 cut(s) 161
AvaII GGWCC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 165
BciVI GTATCC 1 cut(s) 131
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 131
BfuI GTATCC 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 1 cut(s) 162
BmrFI CCNGG 1 cut(s) 165
BsaJI CCNNGG 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 159
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 124
BseMI GCAATG 1 cut(s) 159
Bsp143I GATC 1 cut(s) 65
BspACI CCGC 1 cut(s) 150
BspLI GGNNCC 1 cut(s) 162
BsrDI GCAATG 1 cut(s) 159
BssECI CCNNGG 1 cut(s) 124
BssMI GATC 1 cut(s) 65
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 62
BstKTI GATC 1 cut(s) 68
BstMBI GATC 1 cut(s) 65
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BstSFI CTRYAG 1 cut(s) 131
BsuI GTATCC 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 161
CviJI RGCY 3 cut(s) 22, 50, 61
CviKI_1 RGCY 3 cut(s) 22, 50, 61
DdeI CTNAG 1 cut(s) 62
DpnI GATC 1 cut(s) 67
DpnII GATC 1 cut(s) 65
Eco47I GGWCC 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 163
FaiI YATR 3 cut(s) 89, 143, 171
FspBI CTAG 1 cut(s) 197
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 197
HpyAV CCTTC 2 cut(s) 61, 151
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 65
LpnPI CCDG 4 cut(s) 60, 71, 150, 177
MaeI CTAG 1 cut(s) 197
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 67
MboI GATC 1 cut(s) 65
MboII GAAGA 1 cut(s) 200
MluCI AATT 2 cut(s) 191, 200
MnlI CCTC 2 cut(s) 99, 119
MroXI GAANNNNTTC 1 cut(s) 192
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
NdeII GATC 1 cut(s) 65
NlaIV GGNNCC 1 cut(s) 162
PdmI GAANNNNTTC 1 cut(s) 192
PfoI TCCNGGA 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 162
PspPI GGNCC 1 cut(s) 161
Sau3AI GATC 1 cut(s) 65
Sau96I GGNCC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 165
SetI ASST 1 cut(s) 63
SfcI CTRYAG 1 cut(s) 131
SgeI CNNG 6 cut(s) 59, 70, 92, 137, 176, 177
SinI GGWCC 1 cut(s) 161
Sse9I AATT 2 cut(s) 191, 200
SsiI CCGC 1 cut(s) 150
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 163
TaaI ACNGT 1 cut(s) 135
TasI AATT 2 cut(s) 191, 200
TspDTI ATGAA 1 cut(s) 170
VpaK11BI GGWCC 1 cut(s) 161
XapI RAATTY 2 cut(s) 191, 200
XbaI TCTAGA 1 cut(s) 196
XmnI GAANNNNTTC 1 cut(s) 192
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.