RchiOBHm_Chr2g0156681

Four repeated domains in the Fasciclin I family of proteins, present in many other contexts.

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
73240827 .. 73241272
446 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52546

Sequence Viewer

Length: 357 bp
ATGCCAAATGATGAGGAATTATCAGAAGCTACCATCACTTCAGACCATCTCCCAGAATTCATCTTCAGCCATTCAATGCCAACTGCACTGCACCTCACGCATTTGTTACATTTACCGAATGGAACTCTTGTTCCATCAAATATCCCAAGCAAGATCATCAACGTAACCAATTCCAAAAGATCAGGCCTGTTTGTAAACAACGCCAAAATTGTAACTCCAGATGTGTGTGGAAGCTTCACAATTAGGTGTCATGGTATTAGCACAGCTATGAGATTTGAGAATTTCATGGTTACCACAAAGAAATGTAACAGATTTGATCCACCTACCGACCTACAGATGACCCCAACACAGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.14

Weight (kDa)

6.63

Isoelectric Point (pI)

36.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018294)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G26730
malus_domestica MD09G1122000.v1.1
prunus_persica Prupe.3G201600_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0156681
rosa_laevigata RLG00000020931
rosa_multiflora Rmu_sc0001130.1_g000004
rosa_roxburghii Rroxscaffold_2G00092840
rosa_samantha Rh2BG534200 Rh2DG543000
rosa_wichuraiana Rw2G042990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 311
AcsI RAATTY 2 cut(s) 56, 280
AcuI CTGAAG 2 cut(s) 24, 49
AgsI TTSAA 1 cut(s) 75
AloI GAACNNNNNNTCC 4 cut(s) 114, 115, 146, 147
AluBI AGCT 3 cut(s) 29, 234, 266
AluI AGCT 3 cut(s) 29, 234, 266
AlwI GGATC 1 cut(s) 311
AoxI GGCC 1 cut(s) 184
ApoI RAATTY 2 cut(s) 56, 280
BccI CCATC 3 cut(s) 41, 54, 142
BfmI CTRYAG 1 cut(s) 332
BpmI CTGGAG 1 cut(s) 201
BsgI GTGCAG 2 cut(s) 69, 74
BshFI GGCC 1 cut(s) 186
BsnI GGCC 1 cut(s) 186
Bsp143I GATC 3 cut(s) 153, 179, 316
BspANI GGCC 1 cut(s) 186
BspPI GGATC 1 cut(s) 311
BssMI GATC 3 cut(s) 153, 179, 316
BstEII GGTNACC 1 cut(s) 289
BstKTI GATC 3 cut(s) 156, 182, 319
BstMBI GATC 3 cut(s) 153, 179, 316
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstPI GGTNACC 1 cut(s) 289
BstSFI CTRYAG 1 cut(s) 332
BsuRI GGCC 1 cut(s) 186
BtsI GCAGTG 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 86
CviAII CATG 2 cut(s) 251, 286
CviJI RGCY 5 cut(s) 29, 69, 186, 234, 266
CviKI_1 RGCY 5 cut(s) 29, 69, 186, 234, 266
DpnI GATC 3 cut(s) 155, 181, 318
DpnII GATC 3 cut(s) 153, 179, 316
Eco147I AGGCCT 1 cut(s) 186
Eco57I CTGAAG 2 cut(s) 24, 49
Eco91I GGTNACC 1 cut(s) 289
EcoO65I GGTNACC 1 cut(s) 289
EcoRI GAATTC 1 cut(s) 56
FaeI CATG 2 cut(s) 254, 289
FaiI YATR 3 cut(s) 252, 269, 287
FatI CATG 2 cut(s) 250, 285
GsuI CTGGAG 1 cut(s) 201
HaeIII GGCC 1 cut(s) 186
Hin1II CATG 2 cut(s) 254, 289
HindIII AAGCTT 1 cut(s) 232
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 2 cut(s) 25, 43
Hpy188III TCNNGA 1 cut(s) 218
Hpy8I GTNNAC 1 cut(s) 196
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 2 cut(s) 86, 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 2 cut(s) 254, 289
Kzo9I GATC 3 cut(s) 153, 179, 316
LpnPI CCDG 4 cut(s) 66, 168, 200, 231
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 5 cut(s) 105, 163, 211, 289, 305
MalI GATC 3 cut(s) 155, 181, 318
MboI GATC 3 cut(s) 153, 179, 316
MboII GAAGA 1 cut(s) 55
MluCI AATT 6 cut(s) 17, 56, 169, 207, 240, 280
MnlI CCTC 2 cut(s) 7, 104
MslI CAYNNNNRTG 1 cut(s) 266
MwoI GCNNNNNNNGC 1 cut(s) 97
NdeII GATC 3 cut(s) 153, 179, 316
NlaIII CATG 2 cut(s) 254, 289
PceI AGGCCT 1 cut(s) 186
PspEI GGTNACC 1 cut(s) 289
RseI CAYNNNNRTG 1 cut(s) 266
Sau3AI GATC 3 cut(s) 153, 179, 316
SetI ASST 8 cut(s) 31, 96, 165, 236, 248, 268, 325, 333
SfcI CTRYAG 1 cut(s) 332
SmiMI CAYNNNNRTG 1 cut(s) 266
Sse9I AATT 6 cut(s) 17, 56, 169, 207, 240, 280
SseBI AGGCCT 1 cut(s) 186
StuI AGGCCT 1 cut(s) 186
TaiI ACGT 1 cut(s) 165
TasI AATT 6 cut(s) 17, 56, 169, 207, 240, 280
TscAI CASTG 1 cut(s) 93
TspDTI ATGAA 2 cut(s) 49, 274
TspRI CASTG 1 cut(s) 93
XapI RAATTY 2 cut(s) 56, 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.