Rmu_sc0001130.1_g000004

Four repeated domains in the Fasciclin I family of proteins, present in many other contexts.

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001130.1
Physical Location & Seq
Reverse (-)
25078 .. 25593
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001130.1_g000004.1.cds

Sequence Viewer

Length: 516 bp
atggctttctggtttttcgccctattactatttgcagtcggagattctaagcctgcaaatccaatcaaccaatctcatctgcagtcagccatggctgacatgagaaaggggtcttaccacggttttgttctcctcctgaagatcgtaaacaacagcatcctcgggtcgctgaggaattcaggcataactttcttcatgccaaatgatgaggaattatcagaagctaccatcacttcagaccatctcccagaattcatcttcagtcattcaatgccaactatcgccctattactatttgcagtcggagattctaagcctgcaaatccaatcaaccaatctcatctgcagtcagccatggctgacatgagaaaggggtcttaccacggttttgttctcctcctgaagatcgtaaacaacagcatcctcgggtcgctgaggaattcaggcataactttcttcatgccaaatgatgaggaattatcagaagctaccatcacttcagaccatctcccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

171

Amino Acids

18.81

Weight (kDa)

5.72

Isoelectric Point (pI)

45.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018294)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G26730
malus_domestica MD09G1122000.v1.1
prunus_persica Prupe.3G201600_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0156681
rosa_laevigata RLG00000020931
rosa_multiflora Rmu_sc0001130.1_g000004
rosa_roxburghii Rroxscaffold_2G00092840
rosa_samantha Rh2BG534200 Rh2DG543000
rosa_wichuraiana Rw2G042990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 175, 251, 439
AcuI CTGAAG 5 cut(s) 158, 219, 244, 422, 483
AgsI TTSAA 1 cut(s) 270
AluBI AGCT 2 cut(s) 224, 488
AluI AGCT 2 cut(s) 224, 488
Ama87I CYCGRG 2 cut(s) 161, 425
ApoI RAATTY 3 cut(s) 175, 251, 439
AvaI CYCGRG 2 cut(s) 161, 425
BbvCI CCTCAGC 2 cut(s) 170, 434
BccI CCATC 4 cut(s) 236, 249, 500, 513
BfmI CTRYAG 2 cut(s) 80, 344
BmeT110I CYCGRG 2 cut(s) 161, 425
BmsI GCATC 2 cut(s) 165, 429
Bpu10I CCTNAGC 2 cut(s) 170, 434
BsaJI CCNNGG 6 cut(s) 90, 118, 160, 354, 382, 424
BseDI CCNNGG 6 cut(s) 90, 118, 160, 354, 382, 424
BseGI GGATG 2 cut(s) 156, 420
BseMII CTCAG 2 cut(s) 161, 425
BseRI GAGGAG 2 cut(s) 122, 386
BsiHKCI CYCGRG 2 cut(s) 161, 425
BsoBI CYCGRG 2 cut(s) 161, 425
Bsp143I GATC 2 cut(s) 141, 405
Bsp19I CCATGG 2 cut(s) 90, 354
BspCNI CTCAG 2 cut(s) 162, 426
BspMAI CTGCAG 2 cut(s) 84, 348
BssECI CCNNGG 6 cut(s) 90, 118, 160, 354, 382, 424
BssMI GATC 2 cut(s) 141, 405
BssT1I CCWWGG 2 cut(s) 90, 354
Bst4CI ACNGT 2 cut(s) 122, 386
BstC8I GCNNGC 2 cut(s) 54, 318
BstDEI CTNAG 4 cut(s) 48, 170, 312, 434
BstDSI CCRYGG 4 cut(s) 90, 118, 354, 382
BstF5I GGATG 2 cut(s) 156, 420
BstKTI GATC 2 cut(s) 144, 408
BstMBI GATC 2 cut(s) 141, 405
BstSFI CTRYAG 2 cut(s) 80, 344
BtgI CCRYGG 4 cut(s) 90, 118, 354, 382
BtsCI GGATG 2 cut(s) 156, 420
Cac8I GCNNGC 2 cut(s) 54, 318
CviAII CATG 6 cut(s) 91, 100, 196, 355, 364, 460
CviJI RGCY 9 cut(s) 5, 52, 89, 95, 224, 316, 353, 359, 488
CviKI_1 RGCY 9 cut(s) 5, 52, 89, 95, 224, 316, 353, 359, 488
DdeI CTNAG 4 cut(s) 48, 170, 312, 434
DpnI GATC 2 cut(s) 143, 407
DpnII GATC 2 cut(s) 141, 405
Eco130I CCWWGG 2 cut(s) 90, 354
Eco57I CTGAAG 5 cut(s) 158, 219, 244, 422, 483
Eco88I CYCGRG 2 cut(s) 161, 425
EcoRI GAATTC 3 cut(s) 175, 251, 439
EcoT14I CCWWGG 2 cut(s) 90, 354
ErhI CCWWGG 2 cut(s) 90, 354
FaeI CATG 6 cut(s) 94, 103, 199, 358, 367, 463
FaiI YATR 9 cut(s) 92, 101, 185, 197, 356, 365, 449, 461, 514
FatI CATG 6 cut(s) 90, 99, 195, 354, 363, 459
FokI GGATG 2 cut(s) 143, 407
Hin1II CATG 6 cut(s) 94, 103, 199, 358, 367, 463
HinfI GANTC 2 cut(s) 44, 308
Hpy166II GTNNAC 2 cut(s) 148, 412
Hpy188I TCNGA 6 cut(s) 41, 220, 238, 305, 484, 502
Hpy188III TCNNGA 2 cut(s) 136, 400
Hpy8I GTNNAC 2 cut(s) 148, 412
HpyCH4III ACNGT 2 cut(s) 122, 386
HpyCH4V TGCA 6 cut(s) 35, 56, 82, 299, 320, 346
HpyF3I CTNAG 4 cut(s) 48, 170, 312, 434
Hsp92II CATG 6 cut(s) 94, 103, 199, 358, 367, 463
Kzo9I GATC 2 cut(s) 141, 405
LpnPI CCDG 7 cut(s) 66, 149, 165, 261, 330, 413, 429
LweI GCATC 2 cut(s) 165, 429
MalI GATC 2 cut(s) 143, 407
MboI GATC 2 cut(s) 141, 405
MboII GAAGA 5 cut(s) 151, 184, 250, 415, 448
MluCI AATT 5 cut(s) 175, 212, 251, 439, 476
MmeI TCCRAC 2 cut(s) 19, 283
MnlI CCTC 8 cut(s) 143, 165, 170, 202, 407, 429, 434, 466
NcoI CCATGG 2 cut(s) 90, 354
NdeII GATC 2 cut(s) 141, 405
NlaIII CATG 6 cut(s) 94, 103, 199, 358, 367, 463
PfeI GAWTC 2 cut(s) 44, 308
PstI CTGCAG 2 cut(s) 84, 348
Sau3AI GATC 2 cut(s) 141, 405
SetI ASST 2 cut(s) 226, 490
SfaNI GCATC 2 cut(s) 165, 429
SfcI CTRYAG 2 cut(s) 80, 344
Sse9I AATT 5 cut(s) 175, 212, 251, 439, 476
StyI CCWWGG 2 cut(s) 90, 354
TaaI ACNGT 2 cut(s) 122, 386
TasI AATT 5 cut(s) 175, 212, 251, 439, 476
TfiI GAWTC 2 cut(s) 44, 308
TspDTI ATGAA 3 cut(s) 184, 244, 448
XapI RAATTY 3 cut(s) 175, 251, 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.