RchiOBHm_Chr2g0163621

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
79036101 .. 79040276
4176 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53176

Sequence Viewer

Length: 240 bp
ATGCAGCTAGAAAGATTAAATGGATTGTGGAGGAAGCTCGAAAGCAGCAACAATGAGATCAGTGCTGCTAGAAATCGGTTTGGACAAAGTACATCTGAAAGAGACAATATCCTTGAAGCTCGTCACAAATATGCTTGTCGCCGAAGAGAGATTCAGCAGAGGCTCACGATGCTAAGGTCGACGTTTGTGGTTTACATTTTAGCTTTGCACATCTTCGTCTTCATCAGAATCTCATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.5

Weight (kDa)

11.09

Isoelectric Point (pI)

83.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019365)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 179
AfaI GTAC 1 cut(s) 91
AgsI TTSAA 1 cut(s) 116
AluBI AGCT 4 cut(s) 7, 37, 119, 203
AluI AGCT 4 cut(s) 7, 37, 119, 203
Alw26I GTCTC 1 cut(s) 96
ApeKI GCWGC 3 cut(s) 4, 45, 65
BbsI GAAGAC 1 cut(s) 211
BbvI GCAGC 3 cut(s) 16, 52, 57
BcoDI GTCTC 1 cut(s) 96
BfaI CTAG 2 cut(s) 8, 69
BisI GCNGC 3 cut(s) 5, 46, 66
BlsI GCNGC 3 cut(s) 6, 47, 67
BmsI GCATC 1 cut(s) 159
BpiI GAAGAC 1 cut(s) 211
Bpu10I CCTNAGC 1 cut(s) 173
BseXI GCAGC 3 cut(s) 16, 52, 57
BsmAI GTCTC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 57
BssMI GATC 1 cut(s) 57
Bst6I CTCTTC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 173
BstKTI GATC 1 cut(s) 60
BstMAI GTCTC 1 cut(s) 96
BstMBI GATC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstV1I GCAGC 3 cut(s) 16, 52, 57
BstV2I GAAGAC 1 cut(s) 211
BtsIMutI CAGTG 1 cut(s) 67
Csp6I GTAC 1 cut(s) 90
CviJI RGCY 5 cut(s) 7, 37, 119, 163, 203
CviKI_1 RGCY 5 cut(s) 7, 37, 119, 163, 203
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 1 cut(s) 173
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
FaiI YATR 1 cut(s) 132
FblI GTMKAC 1 cut(s) 179
Fnu4HI GCNGC 3 cut(s) 5, 46, 66
Fsp4HI GCNGC 3 cut(s) 5, 46, 66
FspBI CTAG 2 cut(s) 8, 69
GluI GCNGC 3 cut(s) 5, 46, 66
HincII GTYRAC 1 cut(s) 180
HindII GTYRAC 1 cut(s) 180
HinfI GANTC 2 cut(s) 151, 228
Hpy166II GTNNAC 2 cut(s) 180, 193
Hpy188I TCNGA 2 cut(s) 97, 227
Hpy188III TCNNGA 1 cut(s) 166
Hpy8I GTNNAC 2 cut(s) 180, 193
Hpy99I CGWCG 1 cut(s) 184
HpyCH4IV ACGT 1 cut(s) 182
HpyCH4V TGCA 2 cut(s) 4, 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 173
HpySE526I ACGT 1 cut(s) 182
Kzo9I GATC 1 cut(s) 57
Lsp1109I GCAGC 3 cut(s) 16, 52, 57
LweI GCATC 1 cut(s) 159
MaeI CTAG 2 cut(s) 8, 69
MaeII ACGT 1 cut(s) 182
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 3 cut(s) 156, 205, 211
MnlI CCTC 2 cut(s) 24, 153
MseI TTAA 1 cut(s) 17
MslI CAYNNNNRTG 1 cut(s) 129
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeII GATC 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 122
PfeI GAWTC 2 cut(s) 151, 228
PkrI GCNGC 3 cut(s) 6, 47, 67
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
RseI CAYNNNNRTG 1 cut(s) 129
SalI GTCGAC 1 cut(s) 178
SaqAI TTAA 1 cut(s) 17
SatI GCNGC 3 cut(s) 5, 46, 66
Sau3AI GATC 1 cut(s) 57
SetI ASST 6 cut(s) 9, 39, 121, 179, 185, 205
SfaNI GCATC 1 cut(s) 159
SgeI CNNG 7 cut(s) 20, 50, 81, 125, 132, 147, 178
SmiMI CAYNNNNRTG 1 cut(s) 129
SspMI CTAG 2 cut(s) 8, 69
TaiI ACGT 1 cut(s) 185
TaqI TCGA 2 cut(s) 39, 179
TatI WGTACW 1 cut(s) 89
TfiI GAWTC 2 cut(s) 151, 228
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TscAI CASTG 1 cut(s) 67
TseFI GTSAC 1 cut(s) 122
TseI GCWGC 3 cut(s) 4, 45, 65
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 211
TspRI CASTG 1 cut(s) 67
XmiI GTMKAC 1 cut(s) 179
XspI CTAG 2 cut(s) 8, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.