Rmu_sc0014330.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014330.1
Physical Location & Seq
Forward (+)
34809 .. 35631
823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014330.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
atggaagtagtagttcaagatttagagaaaaaatggggagaaattcaagataatgcactgagccagccttttccagctcaaagagagaagattctggataaacagtatcatagcctcattgagcaactagaagcaaaacaggcacaagcagaagtcctagttggtgaaattcatttgaaagagatgcagctggaaagattaaatggattgtggaggaagctcgaaagcagcaacaatgagatcagtgctgctagaaatcggtttggacaaagtacatctgaaagagacggatttgaagatcgtcacaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

12.02

Weight (kDa)

5.4

Isoelectric Point (pI)

52.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019365)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 42, 168
AfaI GTAC 1 cut(s) 274
AgsI TTSAA 4 cut(s) 17, 47, 178, 296
AjuI GAANNNNNNNTTGG 2 cut(s) 144, 176
AluBI AGCT 3 cut(s) 77, 190, 220
AluI AGCT 3 cut(s) 77, 190, 220
Alw26I GTCTC 1 cut(s) 279
ApeKI GCWGC 3 cut(s) 187, 228, 248
ApoI RAATTY 2 cut(s) 42, 168
AsuHPI GGTGA 1 cut(s) 176
BbvI GCAGC 3 cut(s) 199, 235, 240
BcoDI GTCTC 1 cut(s) 279
BfaI CTAG 3 cut(s) 128, 158, 252
BisI GCNGC 3 cut(s) 188, 229, 249
BlsI GCNGC 3 cut(s) 189, 230, 250
BmsI GCATC 1 cut(s) 174
BseMII CTCAG 1 cut(s) 50
BseXI GCAGC 3 cut(s) 199, 235, 240
BsmAI GTCTC 1 cut(s) 279
BsmBI CGTCTC 1 cut(s) 279
Bsp143I GATC 2 cut(s) 240, 298
BspCNI CTCAG 1 cut(s) 51
BssMI GATC 2 cut(s) 240, 298
Bst4CI ACNGT 1 cut(s) 105
BstC8I GCNNGC 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 59
BstKTI GATC 2 cut(s) 243, 301
BstMAI GTCTC 1 cut(s) 279
BstMBI GATC 2 cut(s) 240, 298
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstV1I GCAGC 3 cut(s) 199, 235, 240
BtsIMutI CAGTG 2 cut(s) 56, 250
Cac8I GCNNGC 1 cut(s) 65
Csp6I GTAC 1 cut(s) 273
CviJI RGCY 6 cut(s) 63, 67, 77, 114, 190, 220
CviKI_1 RGCY 6 cut(s) 63, 67, 77, 114, 190, 220
CviQI GTAC 1 cut(s) 273
DdeI CTNAG 1 cut(s) 59
DpnI GATC 2 cut(s) 242, 300
DpnII GATC 2 cut(s) 240, 298
Esp3I CGTCTC 1 cut(s) 279
FaiI YATR 1 cut(s) 111
Fnu4HI GCNGC 3 cut(s) 188, 229, 249
Fsp4HI GCNGC 3 cut(s) 188, 229, 249
FspBI CTAG 3 cut(s) 128, 158, 252
GluI GCNGC 3 cut(s) 188, 229, 249
HinfI GANTC 1 cut(s) 91
HphI GGTGA 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 280
Hpy188III TCNNGA 3 cut(s) 17, 47, 95
HpyCH4III ACNGT 1 cut(s) 105
HpyCH4V TGCA 2 cut(s) 56, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 59
Kzo9I GATC 2 cut(s) 240, 298
LpnPI CCDG 5 cut(s) 77, 80, 87, 125, 176
Lsp1109I GCAGC 3 cut(s) 199, 235, 240
LweI GCATC 1 cut(s) 174
MaeI CTAG 3 cut(s) 128, 158, 252
MaeIII GTNAC 1 cut(s) 302
MalI GATC 2 cut(s) 242, 300
MboI GATC 2 cut(s) 240, 298
MboII GAAGA 2 cut(s) 100, 308
MluCI AATT 2 cut(s) 42, 168
MnlI CCTC 2 cut(s) 125, 207
MseI TTAA 1 cut(s) 200
MspA1I CMGCKG 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 140
NdeII GATC 2 cut(s) 240, 298
NmuCI GTSAC 1 cut(s) 302
PfeI GAWTC 1 cut(s) 91
PkrI GCNGC 3 cut(s) 189, 230, 250
PvuII CAGCTG 1 cut(s) 190
RsaI GTAC 1 cut(s) 274
RsaNI GTAC 1 cut(s) 273
SaqAI TTAA 1 cut(s) 200
SatI GCNGC 3 cut(s) 188, 229, 249
Sau3AI GATC 2 cut(s) 240, 298
SetI ASST 3 cut(s) 79, 192, 222
SfaNI GCATC 1 cut(s) 174
Sse9I AATT 2 cut(s) 42, 168
SspMI CTAG 3 cut(s) 128, 158, 252
TaaI ACNGT 1 cut(s) 105
TaqI TCGA 1 cut(s) 222
TasI AATT 2 cut(s) 42, 168
TatI WGTACW 1 cut(s) 272
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TscAI CASTG 2 cut(s) 63, 250
TseFI GTSAC 1 cut(s) 302
TseI GCWGC 3 cut(s) 187, 228, 248
Tsp45I GTSAC 1 cut(s) 302
TspDTI ATGAA 1 cut(s) 161
TspGWI ACGGA 1 cut(s) 303
TspRI CASTG 2 cut(s) 63, 250
XapI RAATTY 2 cut(s) 42, 168
XspI CTAG 3 cut(s) 128, 158, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.