Rmu_sc0006596.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006596.1
Physical Location & Seq
Reverse (-)
1533 .. 2059
527 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006596.1_g000002.1.cds

Sequence Viewer

Length: 441 bp
atgaaaatccatgcaagtgtgctacggattgtcataccagcttgtaaagtctctgctctacgcaatttttgttgtgcagctcaaagagagaagattctggataaacagtatcatagccttattgagcaactagaagcaaaacaggcacaagcagaaggcctagttggtgaaattcatttgaaagagatggagctagaaagattaaatggattgtggaggaagcttgaaagcagcaacaatgagatgagcgctgctagaaatcggtttggacgaagcacatctgaaagaggatctgcttcttctgacaatatccttgacgctcatcacaaatatgctggtggccgaacagagaatcagcagaggctcatgctgctcaggtcgatgtttgtgctttacattttagctttgcacatcttagtcttcatcaggatctcattttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

16.68

Weight (kDa)

9.51

Isoelectric Point (pI)

55.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019365)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 298, 437
AcoI YGGCCR 1 cut(s) 340
AcsI RAATTY 1 cut(s) 171
AfeI AGCGCT 1 cut(s) 250
AgsI TTSAA 2 cut(s) 181, 227
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AluBI AGCT 5 cut(s) 41, 80, 193, 223, 404
AluI AGCT 5 cut(s) 41, 80, 193, 223, 404
Alw26I GTCTC 1 cut(s) 55
AlwI GGATC 2 cut(s) 298, 437
Aor51HI AGCGCT 1 cut(s) 250
AoxI GGCC 2 cut(s) 157, 340
ApeKI GCWGC 4 cut(s) 77, 231, 251, 370
ApoI RAATTY 1 cut(s) 171
AspLEI GCGC 1 cut(s) 251
AsuHPI GGTGA 1 cut(s) 179
BbsI GAAGAC 1 cut(s) 412
BbvI GCAGC 4 cut(s) 89, 238, 243, 357
BccI CCATC 1 cut(s) 181
BcgI CGANNNNNNTGC 2 cut(s) 370, 404
BcoDI GTCTC 1 cut(s) 55
BfaI CTAG 4 cut(s) 131, 161, 194, 255
BfoI RGCGCY 1 cut(s) 252
BisI GCNGC 4 cut(s) 78, 232, 252, 371
BlsI GCNGC 4 cut(s) 79, 233, 253, 372
BpiI GAAGAC 1 cut(s) 412
Bpu10I CCTNAGC 1 cut(s) 374
BseMII CTCAG 1 cut(s) 388
BseXI GCAGC 4 cut(s) 89, 238, 243, 357
BsgI GTGCAG 1 cut(s) 96
BshFI GGCC 2 cut(s) 159, 342
BsmAI GTCTC 1 cut(s) 55
BsnI GGCC 2 cut(s) 159, 342
Bsp143I GATC 2 cut(s) 290, 429
BspANI GGCC 2 cut(s) 159, 342
BspCNI CTCAG 1 cut(s) 387
BspPI GGATC 2 cut(s) 298, 437
BssMI GATC 2 cut(s) 290, 429
Bst4CI ACNGT 1 cut(s) 108
BstDEI CTNAG 2 cut(s) 374, 415
BstH2I RGCGCY 1 cut(s) 252
BstHHI GCGC 1 cut(s) 251
BstKTI GATC 2 cut(s) 293, 432
BstMAI GTCTC 1 cut(s) 55
BstMBI GATC 2 cut(s) 290, 429
BstMWI GCNNNNNNNGC 2 cut(s) 143, 370
BstV1I GCAGC 4 cut(s) 89, 238, 243, 357
BstV2I GAAGAC 1 cut(s) 412
BstX2I RGATCY 2 cut(s) 290, 429
BstYI RGATCY 2 cut(s) 290, 429
BsuRI GGCC 2 cut(s) 159, 342
CfoI GCGC 1 cut(s) 251
CseI GACGC 1 cut(s) 326
CviAII CATG 2 cut(s) 11, 367
CviJI RGCY 9 cut(s) 41, 80, 117, 159, 193, 223, 342, 364, 404
CviKI_1 RGCY 9 cut(s) 41, 80, 117, 159, 193, 223, 342, 364, 404
DdeI CTNAG 2 cut(s) 374, 415
DpnI GATC 2 cut(s) 292, 431
DpnII GATC 2 cut(s) 290, 429
EaeI YGGCCR 1 cut(s) 340
Eco147I AGGCCT 1 cut(s) 159
Eco47III AGCGCT 1 cut(s) 250
FaeI CATG 2 cut(s) 14, 370
FaiI YATR 5 cut(s) 12, 35, 114, 333, 368
FatI CATG 2 cut(s) 10, 366
Fnu4HI GCNGC 4 cut(s) 78, 232, 252, 371
Fsp4HI GCNGC 4 cut(s) 78, 232, 252, 371
FspBI CTAG 4 cut(s) 131, 161, 194, 255
GlaI GCGC 1 cut(s) 250
GluI GCNGC 4 cut(s) 78, 232, 252, 371
HaeII RGCGCY 1 cut(s) 252
HaeIII GGCC 2 cut(s) 159, 342
HgaI GACGC 1 cut(s) 326
HhaI GCGC 1 cut(s) 251
Hin1II CATG 2 cut(s) 14, 370
Hin6I GCGC 1 cut(s) 249
HinP1I GCGC 1 cut(s) 249
HindIII AAGCTT 1 cut(s) 221
HinfI GANTC 2 cut(s) 94, 352
HphI GGTGA 1 cut(s) 179
Hpy188I TCNGA 2 cut(s) 283, 304
Hpy188III TCNNGA 2 cut(s) 98, 427
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4V TGCA 3 cut(s) 14, 77, 409
HpyF10VI GCNNNNNNNGC 2 cut(s) 143, 370
HpyF3I CTNAG 2 cut(s) 374, 415
Hsp92II CATG 2 cut(s) 14, 370
HspAI GCGC 1 cut(s) 249
Kzo9I GATC 2 cut(s) 290, 429
LmnI GCTCC 1 cut(s) 190
LpnPI CCDG 6 cut(s) 51, 83, 128, 321, 361, 412
Lsp1109I GCAGC 4 cut(s) 89, 238, 243, 357
MaeI CTAG 4 cut(s) 131, 161, 194, 255
MalI GATC 2 cut(s) 292, 431
MboI GATC 2 cut(s) 290, 429
MboII GAAGA 3 cut(s) 103, 291, 412
MflI RGATCY 2 cut(s) 290, 429
MluCI AATT 2 cut(s) 64, 171
MnlI CCTC 3 cut(s) 210, 281, 354
MseI TTAA 1 cut(s) 203
MslI CAYNNNNRTG 2 cut(s) 15, 330
MwoI GCNNNNNNNGC 2 cut(s) 143, 370
NdeII GATC 2 cut(s) 290, 429
NlaIII CATG 2 cut(s) 14, 370
PceI AGGCCT 1 cut(s) 159
PcsI WCGNNNNNNNCGW 1 cut(s) 268
PfeI GAWTC 2 cut(s) 94, 352
PkrI GCNGC 4 cut(s) 79, 233, 253, 372
PsuI RGATCY 2 cut(s) 290, 429
RseI CAYNNNNRTG 2 cut(s) 15, 330
SaqAI TTAA 1 cut(s) 203
SatI GCNGC 4 cut(s) 78, 232, 252, 371
Sau3AI GATC 2 cut(s) 290, 429
SetI ASST 6 cut(s) 43, 82, 195, 225, 380, 406
SmiMI CAYNNNNRTG 2 cut(s) 15, 330
Sse9I AATT 2 cut(s) 64, 171
SseBI AGGCCT 1 cut(s) 159
SspMI CTAG 4 cut(s) 131, 161, 194, 255
StuI AGGCCT 1 cut(s) 159
TaaI ACNGT 1 cut(s) 108
TaqI TCGA 1 cut(s) 380
TasI AATT 2 cut(s) 64, 171
TfiI GAWTC 2 cut(s) 94, 352
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
TseI GCWGC 4 cut(s) 77, 231, 251, 370
TspDTI ATGAA 3 cut(s) 17, 164, 412
TspGWI ACGGA 1 cut(s) 40
XapI RAATTY 1 cut(s) 171
XspI CTAG 4 cut(s) 131, 161, 194, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.