RchiOBHm_Chr2g0166101

expansin-A23-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
80871659 .. 80872582
924 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53402

Sequence Viewer

Length: 339 bp
ATGGCTAAGTTTCAGAACTTATTCACGTTTGCAGTGTTGTTCGTCAGCACTATTTTGGTGCAAGCCATTGCCGAGAACCTCCCTGTTGGTGAAAAAGATGGCGTTGCTTGGGAGGATGGACATGCAACCTTTTTTGGAGACATGAGTGGCAGAGAAACCTTGAATCCAGAATGGTGCATGCCTACTGCTGGCACTATCAAAATCACTGCAACAAATTTCTGTCCGCCAAATTACGATCCAAAGTTTAATCCGTGGTGCAACCACCCCCCCTCCAAGAAAACATTTTGCACTTGTCCATGCCTATGTTCACAAAACTTGCTCCATACAAAGCTGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.46

Weight (kDa)

6.24

Isoelectric Point (pI)

39.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019883)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0166101
rosa_laevigata RLG00000021585
rosa_multiflora Rmu_sc0006218.1_g000026
rosa_roxburghii Rroxscaffold_2G00085200
rosa_samantha Rh2AG586300 Rh2BG598100 Rh2CG568800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 224
AclWI GGATC 1 cut(s) 230
AcsI RAATTY 1 cut(s) 214
AfiI CCNNNNNNNGG 1 cut(s) 188
AgsI TTSAA 1 cut(s) 163
AluBI AGCT 1 cut(s) 331
AluI AGCT 1 cut(s) 331
Alw26I GTCTC 1 cut(s) 132
AlwI GGATC 1 cut(s) 230
ApoI RAATTY 1 cut(s) 214
Asp700I GAANNNNTTC 1 cut(s) 20
AsuHPI GGTGA 1 cut(s) 101
BccI CCATC 2 cut(s) 92, 110
BcoDI GTCTC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 251
BsaXI ACNNNNNCTCC 2 cut(s) 254, 284
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse3DI GCAATG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 251
BseGI GGATG 1 cut(s) 121
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMI GCAATG 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 235
BspACI CCGC 1 cut(s) 224
BspPI GGATC 1 cut(s) 230
BsrDI GCAATG 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 251
BssMI GATC 1 cut(s) 235
BstC8I GCNNGC 3 cut(s) 63, 179, 190
BstDEI CTNAG 1 cut(s) 6
BstDSI CCRYGG 1 cut(s) 251
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 238
BstMAI GTCTC 1 cut(s) 132
BstMBI GATC 1 cut(s) 235
BstNSI RCATGY 2 cut(s) 125, 181
BtgI CCRYGG 1 cut(s) 251
BtsCI GGATG 1 cut(s) 121
BtsI GCAGTG 2 cut(s) 39, 204
BtsIMutI CAGTG 2 cut(s) 39, 204
Cac8I GCNNGC 3 cut(s) 63, 179, 190
CviAII CATG 4 cut(s) 122, 142, 178, 297
CviJI RGCY 3 cut(s) 5, 65, 331
CviKI_1 RGCY 3 cut(s) 5, 65, 331
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
EciI GGCGGA 1 cut(s) 213
FaeI CATG 4 cut(s) 125, 145, 181, 300
FaiI YATR 7 cut(s) 123, 143, 179, 298, 304, 324, 337
FatI CATG 4 cut(s) 121, 141, 177, 296
FokI GGATG 1 cut(s) 128
Hin1II CATG 4 cut(s) 125, 145, 181, 300
HinfI GANTC 1 cut(s) 163
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 308
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 1 cut(s) 308
HpyCH4IV ACGT 1 cut(s) 26
HpyCH4V TGCA 7 cut(s) 32, 61, 125, 177, 209, 258, 288
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 1 cut(s) 26
Hsp92II CATG 4 cut(s) 125, 145, 181, 300
Kzo9I GATC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 324
LpnPI CCDG 4 cut(s) 96, 174, 180, 317
MaeII ACGT 1 cut(s) 26
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MluCI AATT 2 cut(s) 214, 229
MnlI CCTC 3 cut(s) 89, 106, 280
MroXI GAANNNNTTC 1 cut(s) 20
MseI TTAA 1 cut(s) 246
MslI CAYNNNNRTG 1 cut(s) 301
NdeII GATC 1 cut(s) 235
NlaIII CATG 4 cut(s) 125, 145, 181, 300
NmeAIII GCCGAG 1 cut(s) 97
NspI RCATGY 2 cut(s) 125, 181
PaeI GCATGC 1 cut(s) 181
PdmI GAANNNNTTC 1 cut(s) 20
PfeI GAWTC 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 301
SaqAI TTAA 1 cut(s) 246
Sau3AI GATC 1 cut(s) 235
SetI ASST 5 cut(s) 29, 81, 131, 161, 333
SmiMI CAYNNNNRTG 1 cut(s) 301
SphI GCATGC 1 cut(s) 181
Sse9I AATT 2 cut(s) 214, 229
SsiI CCGC 1 cut(s) 224
TaiI ACGT 1 cut(s) 29
TasI AATT 2 cut(s) 214, 229
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 1 cut(s) 246
Tru9I TTAA 1 cut(s) 246
TscAI CASTG 2 cut(s) 39, 211
TspGWI ACGGA 1 cut(s) 240
TspRI CASTG 2 cut(s) 39, 211
XapI RAATTY 1 cut(s) 214
XceI RCATGY 2 cut(s) 125, 181
XmnI GAANNNNTTC 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.