Rh2CG568800

expansin-A23-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0019883
Physical Location & Seq
Reverse (-)
74909901 .. 74910250
350 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG568800.1

Sequence Viewer

Length: 252 bp
ATGCTTATGTTCACAAAACTTGCTCCATACAAAGCTGGTATAATTCCGGTTAAGTTTCGCAGAGTCCCTTGTGTTAAAAGTGGTGGGATTAAGTTTGAGATCAAGGGAAATCCCAATTGGATTACTGCAACTCCTTTCAATGTCGGCGGTGCAGGTGATGTTTCGGCCCTTGCAATTAAGGGTTCTAACTCCGTCGATTGGGTTCCAATGACTGCAATTGGGGACAAGTTTGGCAGACCTCGGCCAACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DPBB_1 Pollen_allerg_1

Protein Analysis

83

Amino Acids

8.89

Weight (kDa)

10.29

Isoelectric Point (pI)

16.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Expansin_C PF01357 30 - 71 2.3e-09 Expansin C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019883)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0166101
rosa_laevigata RLG00000021585
rosa_multiflora Rmu_sc0006218.1_g000026
rosa_roxburghii Rroxscaffold_2G00085200
rosa_samantha Rh2AG586300 Rh2BG598100 Rh2CG568800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 143
Acc36I ACCTGC 1 cut(s) 143
AciI CCGC 1 cut(s) 147
AcoI YGGCCR 1 cut(s) 242
AfiI CCNNNNNNNGG 1 cut(s) 198
AgsI TTSAA 1 cut(s) 139
AjuI GAANNNNNNNTTGG 2 cut(s) 100, 132
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AoxI GGCC 2 cut(s) 165, 242
AspS9I GGNCC 1 cut(s) 166
AsuHPI GGTGA 1 cut(s) 167
BfuAI ACCTGC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 166
BmiI GGNNCC 1 cut(s) 204
BsaJI CCNNGG 1 cut(s) 239
BsaWI WCCGGW 1 cut(s) 46
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
Bsc4I CCNNNNNNNGG 1 cut(s) 198
BseDI CCNNGG 1 cut(s) 239
BseLI CCNNNNNNNGG 1 cut(s) 198
BsgI GTGCAG 1 cut(s) 171
BshFI GGCC 2 cut(s) 167, 244
BsiSI CCGG 1 cut(s) 47
BslFI GGGAC 2 cut(s) 50, 236
BslI CCNNNNNNNGG 1 cut(s) 198
BsmFI GGGAC 2 cut(s) 50, 236
BsnI GGCC 2 cut(s) 167, 244
Bsp143I GATC 1 cut(s) 99
BspACI CCGC 1 cut(s) 147
BspANI GGCC 2 cut(s) 167, 244
BspLI GGNNCC 1 cut(s) 204
BspMI ACCTGC 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 239
BssMI GATC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 249
BstKTI GATC 1 cut(s) 102
BstMBI GATC 1 cut(s) 99
BsuRI GGCC 2 cut(s) 167, 244
BveI ACCTGC 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 166
CviJI RGCY 3 cut(s) 35, 167, 244
CviKI_1 RGCY 3 cut(s) 35, 167, 244
DdeI CTNAG 1 cut(s) 249
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
EaeI YGGCCR 1 cut(s) 242
FaiI YATR 3 cut(s) 8, 28, 41
FaqI GGGAC 2 cut(s) 50, 236
HaeIII GGCC 2 cut(s) 167, 244
HapII CCGG 1 cut(s) 47
HinfI GANTC 1 cut(s) 63
HpaII CCGG 1 cut(s) 47
HphI GGTGA 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 12
Hpy8I GTNNAC 1 cut(s) 12
Hpy99I CGWCG 1 cut(s) 197
HpyCH4V TGCA 4 cut(s) 128, 152, 173, 215
HpyF3I CTNAG 1 cut(s) 249
Kzo9I GATC 1 cut(s) 99
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 21, 60, 138
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MfeI CAATTG 2 cut(s) 115, 216
MluCI AATT 4 cut(s) 42, 115, 174, 216
MlyI GAGTC 1 cut(s) 72
MnlI CCTC 1 cut(s) 249
MseI TTAA 4 cut(s) 51, 75, 90, 177
MspI CCGG 1 cut(s) 47
MunI CAATTG 2 cut(s) 115, 216
NdeII GATC 1 cut(s) 99
NlaIV GGNNCC 1 cut(s) 204
NmeAIII GCCGAG 1 cut(s) 220
PaqCI CACCTGC 1 cut(s) 143
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
PspN4I GGNNCC 1 cut(s) 204
PspPI GGNCC 1 cut(s) 166
SaqAI TTAA 4 cut(s) 51, 75, 90, 177
Sau3AI GATC 1 cut(s) 99
Sau96I GGNCC 1 cut(s) 166
SchI GAGTC 1 cut(s) 72
SetI ASST 3 cut(s) 37, 157, 241
SgeI CNNG 8 cut(s) 32, 48, 59, 81, 115, 165, 182, 238
Sse9I AATT 4 cut(s) 42, 115, 174, 216
SsiI CCGC 1 cut(s) 147
TaqI TCGA 1 cut(s) 195
TasI AATT 4 cut(s) 42, 115, 174, 216
Tru1I TTAA 4 cut(s) 51, 75, 90, 177
Tru9I TTAA 4 cut(s) 51, 75, 90, 177
TspGWI ACGGA 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.