RchiOBHm_Chr3g0485191

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
31812398 .. 31815057
2660 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44983

Sequence Viewer

Length: 174 bp
ATGGACTCTTTATTGGAATTGATAGGTTGTGAGGGTGACATGGCTACTTCAACTTGTGAATATTCCAAACTATATCACCATTGTCTACACTTTGGTTACTTTGTGCAATGCCTGAGACTTCAAAATGTTTTCTGTGATGAAGAAATTTGTCACCTATTGAGGAACAGCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.66

Weight (kDa)

5.33

Isoelectric Point (pI)

51.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018375)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 85
AcsI RAATTY 1 cut(s) 144
AgsI TTSAA 2 cut(s) 51, 122
Alw26I GTCTC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 144
AsuHPI GGTGA 3 cut(s) 47, 68, 143
BcoDI GTCTC 1 cut(s) 109
Bse3DI GCAATG 1 cut(s) 113
BseMI GCAATG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 104
BsmAI GTCTC 1 cut(s) 109
BspCNI CTCAG 1 cut(s) 105
BsrDI GCAATG 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 113
BstMAI GTCTC 1 cut(s) 109
CviAII CATG 1 cut(s) 40
CviJI RGCY 1 cut(s) 44
CviKI_1 RGCY 1 cut(s) 44
DdeI CTNAG 1 cut(s) 113
FaeI CATG 1 cut(s) 43
FaiI YATR 2 cut(s) 41, 73
FatI CATG 1 cut(s) 39
FblI GTMKAC 1 cut(s) 85
Hin1II CATG 1 cut(s) 43
HinfI GANTC 1 cut(s) 5
HphI GGTGA 3 cut(s) 47, 68, 143
Hpy166II GTNNAC 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 106
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 43
LpnPI CCDG 1 cut(s) 125
MaeIII GTNAC 3 cut(s) 35, 95, 149
MboII GAAGA 1 cut(s) 152
MluCI AATT 2 cut(s) 17, 144
MnlI CCTC 2 cut(s) 25, 153
NlaIII CATG 1 cut(s) 43
NmuCI GTSAC 2 cut(s) 35, 149
SetI ASST 2 cut(s) 28, 156
SgeI CNNG 3 cut(s) 52, 66, 124
Sse9I AATT 2 cut(s) 17, 144
SspI AATATT 1 cut(s) 62
TasI AATT 2 cut(s) 17, 144
TseFI GTSAC 2 cut(s) 35, 149
Tsp45I GTSAC 2 cut(s) 35, 149
TspDTI ATGAA 1 cut(s) 153
XapI RAATTY 1 cut(s) 144
XmiI GTMKAC 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.