RchiOBHm_Chr7g0210011

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
27649970 .. 27650743
774 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18792

Sequence Viewer

Length: 135 bp
ATGGCTACTTCAACTTGTGAATATTCCAAACTATATCACCATTGTCTACACTTTGGTTACTTTGTGCAACGCCTGAGACTTCAAAATGTTTTCTGTGATGAAGAAATTTGTCACCTATTGAGGAACAGCGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

44

Amino Acids

5.34

Weight (kDa)

6.38

Isoelectric Point (pI)

60.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018375)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 105
AgsI TTSAA 2 cut(s) 12, 83
Alw26I GTCTC 1 cut(s) 70
ApoI RAATTY 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 29, 104
BcoDI GTCTC 1 cut(s) 70
BseMII CTCAG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 70
BspCNI CTCAG 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 70
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 1 cut(s) 74
FaiI YATR 1 cut(s) 34
FblI GTMKAC 1 cut(s) 46
FspEI CC 6 cut(s) 39, 40, 53, 86, 106, 128
HphI GGTGA 2 cut(s) 29, 104
Hpy166II GTNNAC 1 cut(s) 47
Hpy8I GTNNAC 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 67
HpyF3I CTNAG 1 cut(s) 74
LpnPI CCDG 1 cut(s) 86
MaeIII GTNAC 2 cut(s) 56, 110
MboII GAAGA 1 cut(s) 113
MluCI AATT 1 cut(s) 105
MnlI CCTC 1 cut(s) 114
NmuCI GTSAC 1 cut(s) 110
SetI ASST 1 cut(s) 117
SgeI CNNG 2 cut(s) 27, 85
Sse9I AATT 1 cut(s) 105
SspI AATATT 1 cut(s) 23
TasI AATT 1 cut(s) 105
TseFI GTSAC 1 cut(s) 110
Tsp45I GTSAC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 114
XapI RAATTY 1 cut(s) 105
XmiI GTMKAC 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.