RchiOBHm_Chr3g0485351

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
32022506 .. 32023702
1197 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44997

Sequence Viewer

Length: 192 bp
ATGATGTTGATGTTATTCGGAGCGATGCGACTGAAGAAGAAGAAGATGAGGAGGACGATGGATGAGGTTGAAGTTGCCGTGAAGCATAAAACTTGCCAATTTTGGAGATTGGGTTCAGTTTTAAAAGTCAGTCGCTGCAAAACTAGTGTAAGTGTAATTTCTCTGTATCCATTTGCTGTTTTTGGTAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.31

Weight (kDa)

10.52

Isoelectric Point (pI)

23.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 53
AgsI TTSAA 1 cut(s) 71
AhlI ACTAGT 1 cut(s) 143
AloI GAACNNNNNNTCC 2 cut(s) 97, 129
AlwNI CAGNNNCTG 1 cut(s) 135
ApeKI GCWGC 1 cut(s) 135
BbvI GCAGC 1 cut(s) 122
BccI CCATC 1 cut(s) 52
BceAI ACGGC 1 cut(s) 62
BciVI GTATCC 1 cut(s) 177
BcuI ACTAGT 1 cut(s) 143
BfaI CTAG 1 cut(s) 144
BfuI GTATCC 1 cut(s) 177
BisI GCNGC 1 cut(s) 136
BlsI GCNGC 1 cut(s) 137
BmsI GCATC 1 cut(s) 15
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
BseGI GGATG 1 cut(s) 67
BseRI GAGGAG 1 cut(s) 64
BseXI GCAGC 1 cut(s) 122
BstF5I GGATG 1 cut(s) 67
BstV1I GCAGC 1 cut(s) 122
BsuI GTATCC 1 cut(s) 177
BtgZI GCGATG 1 cut(s) 38
BtsCI GGATG 1 cut(s) 67
CaiI CAGNNNCTG 1 cut(s) 135
DraI TTTAAA 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 53
FaiI YATR 1 cut(s) 87
Fnu4HI GCNGC 1 cut(s) 136
FokI GGATG 1 cut(s) 74
Fsp4HI GCNGC 1 cut(s) 136
FspBI CTAG 1 cut(s) 144
GluI GCNGC 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 138
LmnI GCTCC 1 cut(s) 20
Lsp1109I GCAGC 1 cut(s) 122
LweI GCATC 1 cut(s) 15
MaeI CTAG 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 185
MboII GAAGA 4 cut(s) 46, 49, 52, 55
MluCI AATT 2 cut(s) 98, 156
MnlI CCTC 3 cut(s) 42, 45, 58
MseI TTAA 1 cut(s) 122
PkrI GCNGC 1 cut(s) 137
PstNI CAGNNNCTG 1 cut(s) 135
SaqAI TTAA 1 cut(s) 122
SatI GCNGC 1 cut(s) 136
SetI ASST 1 cut(s) 69
SfaNI GCATC 1 cut(s) 15
SgeI CNNG 3 cut(s) 91, 105, 156
SpeI ACTAGT 1 cut(s) 143
Sse9I AATT 2 cut(s) 98, 156
SspMI CTAG 1 cut(s) 144
TasI AATT 2 cut(s) 98, 156
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TseI GCWGC 1 cut(s) 135
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.