RLG00000001763

Nucleolar GTP-binding protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
20335833 .. 20337288
1456 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001763

Sequence Viewer

Length: 336 bp
ATGATGTTGATGTTATTCAGAGCGATGCGACTGAAGAAGAAGAAGATGAGGAGGACGATGGATGAGGTTGAAGTTGCCGTGAAGCATAAAACTTGCCAATTTTGGAGATTGGATTCAGCTTTAAAAGTCGGTCGCCACAAAACTAGTCTGGGTCTACTATTCAAATCTCCAGAAATACTTGAAGCTGTTGGTGCATTTCAAAAGACACCAATGGTACTGCACCAACAAAAGGTGTTGGGAAAGGTGGATACTCTGAGGAAAAAGGTTATGTCTGTTGGAAAGGAACATGCATCTCTGTGTGCTAAGGTTGGTATCTCGGTTGTTGAGTACTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.7

Weight (kDa)

10.26

Isoelectric Point (pI)

22.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 53
AfaI GTAC 2 cut(s) 216, 329
AfiI CCNNNNNNNGG 1 cut(s) 229
AgsI TTSAA 4 cut(s) 71, 163, 182, 200
AhlI ACTAGT 1 cut(s) 143
AluBI AGCT 2 cut(s) 119, 185
AluI AGCT 2 cut(s) 119, 185
BccI CCATC 1 cut(s) 52
BceAI ACGGC 1 cut(s) 62
BciVI GTATCC 1 cut(s) 241
BcuI ACTAGT 1 cut(s) 143
BfaI CTAG 1 cut(s) 144
BfuI GTATCC 1 cut(s) 241
BmcAI AGTACT 1 cut(s) 329
BmsI GCATC 2 cut(s) 15, 299
BpmI CTGGAG 1 cut(s) 153
Bpu10I CCTNAGC 1 cut(s) 303
Bsc4I CCNNNNNNNGG 1 cut(s) 229
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 245
BseRI GAGGAG 1 cut(s) 64
BsgI GTGCAG 1 cut(s) 203
Bsh1285I CGRYCG 1 cut(s) 133
BsiEI CGRYCG 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 229
BspCNI CTCAG 1 cut(s) 246
BstDEI CTNAG 2 cut(s) 254, 303
BstF5I GGATG 1 cut(s) 67
BstMCI CGRYCG 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNSI RCATGY 1 cut(s) 290
BsuI GTATCC 1 cut(s) 241
BtgZI GCGATG 1 cut(s) 38
BtsCI GGATG 1 cut(s) 67
Csp6I GTAC 2 cut(s) 215, 328
CviAII CATG 1 cut(s) 287
CviJI RGCY 2 cut(s) 119, 185
CviKI_1 RGCY 2 cut(s) 119, 185
CviQI GTAC 2 cut(s) 215, 328
DdeI CTNAG 2 cut(s) 254, 303
DraI TTTAAA 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 53
EcoT22I ATGCAT 1 cut(s) 292
FaeI CATG 1 cut(s) 290
FaiI YATR 4 cut(s) 87, 269, 288, 334
FatI CATG 1 cut(s) 286
FblI GTMKAC 1 cut(s) 154
FokI GGATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 144
GsuI CTGGAG 1 cut(s) 153
Hin1II CATG 1 cut(s) 290
HinfI GANTC 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 2 cut(s) 20, 255
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4V TGCA 3 cut(s) 194, 220, 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 2 cut(s) 254, 303
Hsp92II CATG 1 cut(s) 290
LpnPI CCDG 2 cut(s) 134, 183
LweI GCATC 2 cut(s) 15, 299
MaeI CTAG 1 cut(s) 144
MboII GAAGA 4 cut(s) 46, 49, 52, 55
MluCI AATT 1 cut(s) 98
MmeI TCCRAC 1 cut(s) 256
MnlI CCTC 4 cut(s) 42, 45, 58, 249
Mph1103I ATGCAT 1 cut(s) 292
MseI TTAA 1 cut(s) 122
MslI CAYNNNNRTG 1 cut(s) 295
MwoI GCNNNNNNNGC 1 cut(s) 191
NlaIII CATG 1 cut(s) 290
NsiI ATGCAT 1 cut(s) 292
NspI RCATGY 1 cut(s) 290
PfeI GAWTC 1 cut(s) 113
RsaI GTAC 2 cut(s) 216, 329
RsaNI GTAC 2 cut(s) 215, 328
RseI CAYNNNNRTG 1 cut(s) 295
SaqAI TTAA 1 cut(s) 122
ScaI AGTACT 1 cut(s) 329
SetI ASST 7 cut(s) 69, 121, 187, 234, 246, 267, 309
SfaNI GCATC 2 cut(s) 15, 299
SgeI CNNG 8 cut(s) 91, 105, 156, 161, 182, 191, 299, 328
SmiMI CAYNNNNRTG 1 cut(s) 295
SpeI ACTAGT 1 cut(s) 143
Sse9I AATT 1 cut(s) 98
SspMI CTAG 1 cut(s) 144
TaqII GACCGA 1 cut(s) 119
TasI AATT 1 cut(s) 98
TatI WGTACW 1 cut(s) 327
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
XceI RCATGY 1 cut(s) 290
XmiI GTMKAC 1 cut(s) 154
XspI CTAG 1 cut(s) 144
ZrmI AGTACT 1 cut(s) 329
Zsp2I ATGCAT 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.