RchiOBHm_Chr4g0432691

Cytochrome p450

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0021395
Physical Location & Seq
Reverse (-)
56793979 .. 56794248
270 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40126

Sequence Viewer

Length: 249 bp
ATGAAGAAAGCACAAGAAGAAGTTAGAAACCTCGTCAGAAACAAAGGGAAAGTCTCTGAAAGTGATATCAAACAACTTCAATACCTCAAGATGATTGTGAAAGAAACACTTCAATTGCATCCTCCAGCTCCTTTGATTCCTAGAGAGACCATGTCTCCGATTAAAGGCCTTGGTTATGATATGGAACCAAAAACAATAATCCTTAGGGATTTTTCTTTCAAATTATATATGTCTAAAACTCTAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
p450

Protein Analysis

82

Amino Acids

9.55

Weight (kDa)

9.74

Isoelectric Point (pI)

64.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 1 - 68 7.7e-14 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021395)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0432691
rosa_multiflora Rmu_sc0005610.1_g000002 Rmu_sc0008245.1_g000001 Rmu_sc0012180.1_g000013
rosa_samantha Rh4AG316200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 3 cut(s) 80, 113, 220
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 3 cut(s) 58, 140, 159
AoxI GGCC 1 cut(s) 166
ArsI GACNNNNNNTTYG 2 cut(s) 36, 68
Asp700I GAANNNNTTC 1 cut(s) 108
AxyI CCTNAGG 1 cut(s) 203
BcoDI GTCTC 3 cut(s) 58, 140, 159
BfaI CTAG 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 186
BmsI GCATC 1 cut(s) 127
BpmI CTGGAG 1 cut(s) 108
BpuEI CTTGAG 1 cut(s) 71
BsaI GGTCTC 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 169
BsaXI ACNNNNNCTCC 2 cut(s) 139, 169
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse21I CCTNAGG 1 cut(s) 203
BseDI CCNNGG 1 cut(s) 169
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 164
BshFI GGCC 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 3 cut(s) 58, 140, 159
BsnI GGCC 1 cut(s) 168
Bso31I GGTCTC 1 cut(s) 140
BspANI GGCC 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 186
BspTNI GGTCTC 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 169
BssT1I CCWWGG 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 203
BstF5I GGATG 1 cut(s) 118
BstMAI GTCTC 3 cut(s) 58, 140, 159
Bsu36I CCTNAGG 1 cut(s) 203
BsuRI GGCC 1 cut(s) 168
BtsCI GGATG 1 cut(s) 118
CviAII CATG 1 cut(s) 151
CviJI RGCY 2 cut(s) 128, 168
CviKI_1 RGCY 2 cut(s) 128, 168
DdeI CTNAG 1 cut(s) 203
Eco130I CCWWGG 1 cut(s) 169
Eco147I AGGCCT 1 cut(s) 168
Eco31I GGTCTC 1 cut(s) 140
Eco32I GATATC 1 cut(s) 67
Eco81I CCTNAGG 1 cut(s) 203
EcoRV GATATC 1 cut(s) 67
EcoT14I CCWWGG 1 cut(s) 169
ErhI CCWWGG 1 cut(s) 169
FaeI CATG 1 cut(s) 154
FaiI YATR 6 cut(s) 152, 177, 182, 226, 228, 230
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FatI CATG 1 cut(s) 150
FokI GGATG 1 cut(s) 105
FspBI CTAG 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 1 cut(s) 168
Hin1II CATG 1 cut(s) 154
HinfI GANTC 1 cut(s) 136
Hpy188I TCNGA 3 cut(s) 38, 58, 159
Hpy188III TCNNGA 1 cut(s) 88
HpyCH4V TGCA 1 cut(s) 118
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 1 cut(s) 154
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 1 cut(s) 138
LweI GCATC 1 cut(s) 127
MaeI CTAG 1 cut(s) 141
MboII GAAGA 2 cut(s) 16, 29
MfeI CAATTG 1 cut(s) 113
MluCI AATT 3 cut(s) 113, 221, 244
MnlI CCTC 3 cut(s) 41, 95, 132
MroXI GAANNNNTTC 1 cut(s) 108
MseI TTAA 1 cut(s) 162
MunI CAATTG 1 cut(s) 113
NlaIII CATG 1 cut(s) 154
NlaIV GGNNCC 1 cut(s) 186
PceI AGGCCT 1 cut(s) 168
PdmI GAANNNNTTC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 136
PflFI GACNNNGTC 1 cut(s) 151
PspN4I GGNNCC 1 cut(s) 186
PsyI GACNNNGTC 1 cut(s) 151
SaqAI TTAA 1 cut(s) 162
SetI ASST 3 cut(s) 33, 87, 130
SfaNI GCATC 1 cut(s) 127
SgeI CNNG 7 cut(s) 26, 44, 100, 137, 153, 163, 182
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 3 cut(s) 113, 221, 244
SseBI AGGCCT 1 cut(s) 168
SspMI CTAG 1 cut(s) 141
StuI AGGCCT 1 cut(s) 168
StyI CCWWGG 1 cut(s) 169
TasI AATT 3 cut(s) 113, 221, 244
TfiI GAWTC 1 cut(s) 136
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 17
Tth111I GACNNNGTC 1 cut(s) 151
XmnI GAANNNNTTC 1 cut(s) 108
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.