RchiOBHm_Chr7g0191181
NAC Family

inactive receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
10006529 .. 10006806
278 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17082

Sequence Viewer

Length: 240 bp
ATGAGGTATCCAGGCATAGAGGAAGAAATGGTGGAGATGTTACAGATAGCTATGTCTTGCGTGGTAAGATTGCCAGATCAGCGACCTAAGATGCTGGATGTAGTGAAGATGATAGAAAACGTGCGGCGGATGGATAATGAGAATCGTCCATCTTCTGGAAACAGATCAGAAAGCACAACACCCCTCGGATCAACACCGCCGCCAGTAGTTGGAACACCCCAATCAACCTCAAAAGAGTGA
Functional Annotation

Protein Analysis

79

Amino Acids

8.86

Weight (kDa)

5.44

Isoelectric Point (pI)

89.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017737)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 155, 209
AciI CCGC 4 cut(s) 124, 127, 197, 200
AclWI GGATC 1 cut(s) 196
AfiI CCNNNNNNNGG 2 cut(s) 155, 209
AjnI CCWGG 1 cut(s) 10
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AlwI GGATC 1 cut(s) 196
BccI CCATC 2 cut(s) 124, 157
BciT130I CCWGG 1 cut(s) 12
BciVI GTATCC 1 cut(s) 18
BfuI GTATCC 1 cut(s) 18
BisI GCNGC 2 cut(s) 125, 200
BlsI GCNGC 2 cut(s) 126, 201
Bme1390I CCNGG 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 12
BmsI GCATC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 184
Bsc4I CCNNNNNNNGG 2 cut(s) 155, 209
Bse1I ACTGG 1 cut(s) 203
BseBI CCWGG 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 2 cut(s) 103, 135
BseLI CCNNNNNNNGG 2 cut(s) 155, 209
BseNI ACTGG 1 cut(s) 203
BslI CCNNNNNNNGG 2 cut(s) 155, 209
Bsp143I GATC 3 cut(s) 76, 164, 188
BspACI CCGC 4 cut(s) 124, 127, 197, 200
BspPI GGATC 1 cut(s) 196
BsrI ACTGG 1 cut(s) 203
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 3 cut(s) 76, 164, 188
Bst2UI CCWGG 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 87
BstF5I GGATG 2 cut(s) 103, 135
BstKTI GATC 3 cut(s) 79, 167, 191
BstMBI GATC 3 cut(s) 76, 164, 188
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BsuI GTATCC 1 cut(s) 18
BtsCI GGATG 2 cut(s) 103, 135
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
DdeI CTNAG 1 cut(s) 87
DpnI GATC 3 cut(s) 78, 166, 190
DpnII GATC 3 cut(s) 76, 164, 188
EciI GGCGGA 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 10
FaiI YATR 2 cut(s) 17, 53
Fnu4HI GCNGC 2 cut(s) 125, 200
FokI GGATG 2 cut(s) 110, 142
Fsp4HI GCNGC 2 cut(s) 125, 200
GluI GCNGC 2 cut(s) 125, 200
HinfI GANTC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 169, 188
Hpy188III TCNNGA 1 cut(s) 156
HpyCH4IV ACGT 1 cut(s) 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 120
Kzo9I GATC 3 cut(s) 76, 164, 188
LpnPI CCDG 5 cut(s) 24, 80, 87, 141, 216
LweI GCATC 1 cut(s) 81
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 39
MalI GATC 3 cut(s) 78, 166, 190
MboI GATC 3 cut(s) 76, 164, 188
MboII GAAGA 3 cut(s) 35, 118, 144
MmeI TCCRAC 1 cut(s) 190
MnlI CCTC 3 cut(s) 13, 194, 238
MspR9I CCNGG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 79
NdeII GATC 3 cut(s) 76, 164, 188
PfeI GAWTC 1 cut(s) 142
PflMI CCANNNNNTGG 2 cut(s) 155, 209
PkrI GCNGC 2 cut(s) 126, 201
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
SatI GCNGC 2 cut(s) 125, 200
Sau3AI GATC 3 cut(s) 76, 164, 188
ScrFI CCNGG 1 cut(s) 12
SetI ASST 5 cut(s) 8, 52, 88, 123, 230
SfaNI GCATC 1 cut(s) 81
SsiI CCGC 4 cut(s) 124, 127, 197, 200
StyD4I CCNGG 1 cut(s) 10
TaiI ACGT 1 cut(s) 123
TauI GCSGC 2 cut(s) 127, 202
TfiI GAWTC 1 cut(s) 142
Van91I CCANNNNNTGG 2 cut(s) 155, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.