Rh7CG121500
NAC Family

inactive receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
9385794 .. 9387395
1602 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG121500.1

Sequence Viewer

Length: 393 bp
ATGTGTACAGCTTTGGGGTTGTGTTACTCGAACTCCTCACTGGAAAATTCCCCCATCCATACTACTGCTGGTGATGAGATTGTCCACTTGGTCAGGTGGGTTCATTCAGTTGTTCGTGAGGAGTGGACAGCAGAAGTATTTGACTTAGAACTGATGAGGTATCCAGGCATAGAGGAAGAAATGGTGGAGATGTTACAGATAGCTATGTCTTGCGTGGTAAGAATGCCAGATCAGCGACCTAAGATGCTGGATGTAGTGAAGATGATAGAAAACGTGCGGCGGATGGATAATGAGAATCGTCCATCTTCTGGAAACAGATCAGAAATCACAACACCCCTCGGATCAACACCGCCGCCAGTAGTTGGAACACCCCAATCAACCTCAAAAGAGTGA
Functional Annotation

Protein Analysis

130

Amino Acids

14.65

Weight (kDa)

4.96

Isoelectric Point (pI)

73.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017737)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 308, 362
AciI CCGC 4 cut(s) 277, 280, 350, 353
AclWI GGATC 1 cut(s) 349
AcsI RAATTY 1 cut(s) 46
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 2 cut(s) 308, 362
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 2 cut(s) 11, 203
AluI AGCT 2 cut(s) 11, 203
AlwI GGATC 1 cut(s) 349
ApoI RAATTY 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 83
BccI CCATC 3 cut(s) 62, 277, 310
BciT130I CCWGG 1 cut(s) 165
BciVI GTATCC 1 cut(s) 171
BfuI GTATCC 1 cut(s) 171
BisI GCNGC 2 cut(s) 278, 353
BlsI GCNGC 2 cut(s) 279, 354
Bme1390I CCNGG 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 165
BmsI GCATC 1 cut(s) 234
BsaJI CCNNGG 1 cut(s) 337
BsaXI ACNNNNNCTCC 2 cut(s) 17, 47
Bsc4I CCNNNNNNNGG 2 cut(s) 308, 362
Bse1I ACTGG 2 cut(s) 45, 356
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 337
BseGI GGATG 3 cut(s) 54, 256, 288
BseLI CCNNNNNNNGG 2 cut(s) 308, 362
BseNI ACTGG 2 cut(s) 45, 356
BseRI GAGGAG 2 cut(s) 25, 134
BslI CCNNNNNNNGG 2 cut(s) 308, 362
BsmI GAATGC 1 cut(s) 228
Bsp1407I TGTACA 1 cut(s) 5
Bsp143I GATC 3 cut(s) 229, 317, 341
BspACI CCGC 4 cut(s) 277, 280, 350, 353
BspPI GGATC 1 cut(s) 349
BsrGI TGTACA 1 cut(s) 5
BsrI ACTGG 2 cut(s) 45, 356
BssECI CCNNGG 1 cut(s) 337
BssMI GATC 3 cut(s) 229, 317, 341
Bst2UI CCWGG 1 cut(s) 165
BstAUI TGTACA 1 cut(s) 5
BstDEI CTNAG 2 cut(s) 145, 240
BstF5I GGATG 3 cut(s) 54, 256, 288
BstKTI GATC 3 cut(s) 232, 320, 344
BstMBI GATC 3 cut(s) 229, 317, 341
BstMWI GCNNNNNNNGC 1 cut(s) 232
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BsuI GTATCC 1 cut(s) 171
BtsCI GGATG 3 cut(s) 54, 256, 288
BtsIMutI CAGTG 1 cut(s) 38
Csp6I GTAC 1 cut(s) 6
CviJI RGCY 2 cut(s) 11, 203
CviKI_1 RGCY 2 cut(s) 11, 203
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 2 cut(s) 145, 240
DpnI GATC 3 cut(s) 231, 319, 343
DpnII GATC 3 cut(s) 229, 317, 341
EciI GGCGGA 1 cut(s) 295
EcoRII CCWGG 1 cut(s) 163
FaiI YATR 3 cut(s) 60, 170, 206
Fnu4HI GCNGC 2 cut(s) 278, 353
FokI GGATG 3 cut(s) 41, 263, 295
Fsp4HI GCNGC 2 cut(s) 278, 353
GluI GCNGC 2 cut(s) 278, 353
HinfI GANTC 1 cut(s) 295
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 3 cut(s) 6, 85, 126
Hpy188I TCNGA 2 cut(s) 322, 341
Hpy188III TCNNGA 2 cut(s) 116, 309
Hpy8I GTNNAC 3 cut(s) 6, 85, 126
HpyCH4IV ACGT 1 cut(s) 273
HpyF10VI GCNNNNNNNGC 1 cut(s) 232
HpyF3I CTNAG 2 cut(s) 145, 240
HpySE526I ACGT 1 cut(s) 273
Kzo9I GATC 3 cut(s) 229, 317, 341
LpnPI CCDG 9 cut(s) 26, 54, 79, 150, 177, 233, 240, 294, 369
LweI GCATC 1 cut(s) 234
MaeII ACGT 1 cut(s) 273
MaeIII GTNAC 2 cut(s) 23, 192
MalI GATC 3 cut(s) 231, 319, 343
MboI GATC 3 cut(s) 229, 317, 341
MboII GAAGA 3 cut(s) 188, 271, 297
MluCI AATT 1 cut(s) 46
MmeI TCCRAC 1 cut(s) 343
MnlI CCTC 6 cut(s) 46, 112, 150, 166, 347, 391
MspR9I CCNGG 1 cut(s) 165
Mva1269I GAATGC 1 cut(s) 228
MvaI CCWGG 1 cut(s) 165
MwoI GCNNNNNNNGC 1 cut(s) 232
NdeII GATC 3 cut(s) 229, 317, 341
PctI GAATGC 1 cut(s) 228
PfeI GAWTC 1 cut(s) 295
PflMI CCANNNNNTGG 2 cut(s) 308, 362
PkrI GCNGC 2 cut(s) 279, 354
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SatI GCNGC 2 cut(s) 278, 353
Sau3AI GATC 3 cut(s) 229, 317, 341
ScrFI CCNGG 1 cut(s) 165
SetI ASST 7 cut(s) 13, 98, 161, 205, 241, 276, 383
SfaNI GCATC 1 cut(s) 234
Sse9I AATT 1 cut(s) 46
SsiI CCGC 4 cut(s) 277, 280, 350, 353
StyD4I CCNGG 1 cut(s) 163
TaiI ACGT 1 cut(s) 276
TaqI TCGA 1 cut(s) 29
TasI AATT 1 cut(s) 46
TatI WGTACW 1 cut(s) 5
TauI GCSGC 2 cut(s) 280, 355
TfiI GAWTC 1 cut(s) 295
TscAI CASTG 1 cut(s) 45
TspDTI ATGAA 1 cut(s) 92
TspRI CASTG 1 cut(s) 45
Van91I CCANNNNNTGG 2 cut(s) 308, 362
XapI RAATTY 1 cut(s) 46
XcmI CCANNNNNNNNNTGG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.