RchiOBHm_Chr7g0221081

One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it nucleates assembly of the head domain of the 30S subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0018726
Physical Location & Seq
Reverse (-)
42037767 .. 42038102
336 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19786

Sequence Viewer

Length: 336 bp
ATGCTCATGTCACGTCGAGGTACTGCAGAAGAAAAATTTGCAAAATCCGATCCAATTTATCGTAGTCGATTAGCTAACATGTTGGTTAACCGTATTCTGAAACACGGAAAAAAATCATTGGCTTATCAAATTATCTATCAAGCCATGAAAAAGATTCAACAAAAGACAAAAACAAATCCATTATCTGTTTTACGTCAAGCAATACGTGGAGTAACTCCGGATATAGCAGTAAAAGCAAGACATGTAGGTGGATCGACTCATCAAGTTCCCATTGAAATAGGATCCACACTAGGAAAAGCACTTGCCATTCGTTGGTTATTGCCATTAACAATGTAA

Protein Analysis

111

Amino Acids

12.45

Weight (kDa)

11.11

Isoelectric Point (pI)

42.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S7 PF00177 5 - 107 7.8e-32 Ribosomal protein S7p/S5e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018726)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00900 ATCG01240
malus_domestica MD01G1004700.v1.1
rosa_chinensis RchiOBHm_Chr7g0221081
rosa_laevigata RLG00000037095
rosa_roxburghii Rroxscaffold_2G00119210 Rroxscaffold_4G00323470
rosa_samantha Rh1CG032000 Rh5BG347900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 312
AccIII TCCGGA 1 cut(s) 217
AclWI GGATC 4 cut(s) 44, 259, 276, 289
AcsI RAATTY 1 cut(s) 35
AfaI GTAC 1 cut(s) 22
AfiI CCNNNNNNNGG 1 cut(s) 312
AflIII ACRYGT 2 cut(s) 78, 241
AgsI TTSAA 2 cut(s) 158, 275
AjiI CACGTC 1 cut(s) 14
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AlwI GGATC 4 cut(s) 44, 259, 276, 289
Aor13HI TCCGGA 1 cut(s) 217
ApoI RAATTY 1 cut(s) 35
BamHI GGATCC 1 cut(s) 281
BfaI CTAG 1 cut(s) 290
BfmI CTRYAG 1 cut(s) 24
BmgBI CACGTC 1 cut(s) 14
BmiI GGNNCC 1 cut(s) 283
BsaAI YACGTR 1 cut(s) 206
BsaWI WCCGGW 1 cut(s) 217
Bsc4I CCNNNNNNNGG 1 cut(s) 312
BseAI TCCGGA 1 cut(s) 217
BseLI CCNNNNNNNGG 1 cut(s) 312
BsiSI CCGG 1 cut(s) 218
BslI CCNNNNNNNGG 1 cut(s) 312
Bsp13I TCCGGA 1 cut(s) 217
Bsp143I GATC 3 cut(s) 49, 251, 281
BspEI TCCGGA 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 283
BspMAI CTGCAG 1 cut(s) 28
BspPI GGATC 4 cut(s) 44, 259, 276, 289
BssMI GATC 3 cut(s) 49, 251, 281
Bst4CI ACNGT 1 cut(s) 92
BstBAI YACGTR 1 cut(s) 206
BstKTI GATC 3 cut(s) 52, 254, 284
BstMBI GATC 3 cut(s) 49, 251, 281
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstNSI RCATGY 2 cut(s) 82, 245
BstSFI CTRYAG 1 cut(s) 24
BstX2I RGATCY 1 cut(s) 281
BstYI RGATCY 1 cut(s) 281
BtrI CACGTC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 21
CviAII CATG 4 cut(s) 7, 79, 145, 242
CviJI RGCY 3 cut(s) 74, 122, 143
CviKI_1 RGCY 3 cut(s) 74, 122, 143
CviQI GTAC 1 cut(s) 21
DpnI GATC 3 cut(s) 51, 253, 283
DpnII GATC 3 cut(s) 49, 251, 281
FaeI CATG 4 cut(s) 10, 82, 148, 245
FaiI YATR 5 cut(s) 8, 80, 146, 224, 243
FatI CATG 4 cut(s) 6, 78, 144, 241
FspBI CTAG 1 cut(s) 290
HapII CCGG 1 cut(s) 218
Hin1II CATG 4 cut(s) 10, 82, 148, 245
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 2 cut(s) 154, 256
HpaI GTTAAC 1 cut(s) 88
HpaII CCGG 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 49, 99
Hpy188III TCNNGA 1 cut(s) 218
Hpy8I GTNNAC 1 cut(s) 88
Hpy99I CGWCG 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 92
HpyCH4IV ACGT 3 cut(s) 13, 193, 205
HpyCH4V TGCA 2 cut(s) 26, 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpySE526I ACGT 3 cut(s) 13, 193, 205
Hsp92II CATG 4 cut(s) 10, 82, 148, 245
Kpn2I TCCGGA 1 cut(s) 217
KspAI GTTAAC 1 cut(s) 88
Kzo9I GATC 3 cut(s) 49, 251, 281
LpnPI CCDG 1 cut(s) 231
MaeI CTAG 1 cut(s) 290
MaeII ACGT 3 cut(s) 13, 193, 205
MaeIII GTNAC 2 cut(s) 9, 211
MalI GATC 3 cut(s) 51, 253, 283
MboI GATC 3 cut(s) 49, 251, 281
MboII GAAGA 1 cut(s) 41
MflI RGATCY 1 cut(s) 281
MluCI AATT 3 cut(s) 35, 54, 129
MlyI GAGTC 1 cut(s) 250
MnlI CCTC 1 cut(s) 11
MroI TCCGGA 1 cut(s) 217
MseI TTAA 2 cut(s) 87, 326
MslI CAYNNNNRTG 1 cut(s) 246
MspI CCGG 1 cut(s) 218
MwoI GCNNNNNNNGC 1 cut(s) 233
NdeII GATC 3 cut(s) 49, 251, 281
NlaIII CATG 4 cut(s) 10, 82, 148, 245
NlaIV GGNNCC 1 cut(s) 283
NmuCI GTSAC 1 cut(s) 9
NspI RCATGY 2 cut(s) 82, 245
PciI ACATGT 2 cut(s) 78, 241
PfeI GAWTC 1 cut(s) 154
PflMI CCANNNNNTGG 1 cut(s) 312
PleI GAGTC 1 cut(s) 250
PpsI GAGTC 1 cut(s) 250
Ppu21I YACGTR 1 cut(s) 206
PscI ACATGT 2 cut(s) 78, 241
PspN4I GGNNCC 1 cut(s) 283
PstI CTGCAG 1 cut(s) 28
PsuI RGATCY 1 cut(s) 281
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
RseI CAYNNNNRTG 1 cut(s) 246
SaqAI TTAA 2 cut(s) 87, 326
Sau3AI GATC 3 cut(s) 49, 251, 281
SchI GAGTC 1 cut(s) 250
SetI ASST 6 cut(s) 16, 22, 76, 196, 208, 250
SfcI CTRYAG 1 cut(s) 24
SmiMI CAYNNNNRTG 1 cut(s) 246
Sse9I AATT 3 cut(s) 35, 54, 129
SspMI CTAG 1 cut(s) 290
TaaI ACNGT 1 cut(s) 92
TaiI ACGT 3 cut(s) 16, 196, 208
TaqI TCGA 3 cut(s) 16, 67, 254
TasI AATT 3 cut(s) 35, 54, 129
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 2 cut(s) 87, 326
Tru9I TTAA 2 cut(s) 87, 326
TseFI GTSAC 1 cut(s) 9
Tsp45I GTSAC 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 161
TspGWI ACGGA 1 cut(s) 120
Van91I CCANNNNNTGG 1 cut(s) 312
XapI RAATTY 1 cut(s) 35
XceI RCATGY 2 cut(s) 82, 245
XspI CTAG 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.