RchiOBHm_Chr7g0229641
ERF Family

P-loop nucleoside triphosphate hydrolase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0020603
Physical Location & Seq
Forward (+)
53191340 .. 53192769
1430 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20572

Sequence Viewer

Length: 363 bp
ATGATGAGACTTTGGAAGATTATTTGGGCTGAAATCCTTGGTCTGTGTGGAAATCGCCGTGTGCTTTTTGATAACATGACCAAGGATGAAAGCAAGAGGTTCGAACAAGTGCAGCAGCTTCTCTCGCTTGTGAACTCGGTTATAGCACAGAATGGTGGGCGGCCATACACGGATGGGATATTTGCTGAAGTGAAGAAAGGGGCTATGAAACTTCGTGATCAACAAGAAGAGGTTGCTTCTTTGAAGGCGTATTCAAAACGAGAAATATCTCATTTGAATGAGCAGATGCACCTTGCACATGATCTGCAGCTTAAACGAATTACTGAGATGGTAAATTTTCATCTGCATTTTGTTTGCATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AIG1

Protein Analysis

120

Amino Acids

14.03

Weight (kDa)

9.0

Isoelectric Point (pI)

42.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIG1 PF04548 11 - 75 2.4e-14 AIG1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020603)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0229641 RchiOBHm_Chr7g0230021
rosa_multiflora Rmu_sc0002666.1_g000017 Rmu_sc0004929.1_g000005 Rmu_sc0028893.1_g000001
rosa_samantha Rh7DG404100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 160
AcoI YGGCCR 1 cut(s) 161
AcsI RAATTY 1 cut(s) 334
AcuI CTGAAG 1 cut(s) 207
AgsI TTSAA 3 cut(s) 244, 255, 277
AluBI AGCT 2 cut(s) 118, 310
AluI AGCT 2 cut(s) 118, 310
AoxI GGCC 1 cut(s) 161
ApeKI GCWGC 3 cut(s) 112, 115, 307
ApoI RAATTY 1 cut(s) 334
AsuII TTCGAA 1 cut(s) 102
BbvI GCAGC 3 cut(s) 124, 127, 319
BccI CCATC 2 cut(s) 167, 322
BceAI ACGGC 1 cut(s) 42
BcgI CGANNNNNNTGC 2 cut(s) 82, 116
BclI TGATCA 1 cut(s) 217
BfmI CTRYAG 1 cut(s) 305
BisI GCNGC 4 cut(s) 113, 116, 161, 308
BlsI GCNGC 4 cut(s) 114, 117, 162, 309
BmsI GCATC 1 cut(s) 276
Bpu14I TTCGAA 1 cut(s) 102
BsaJI CCNNGG 2 cut(s) 37, 81
BseDI CCNNGG 2 cut(s) 37, 81
BseGI GGATG 2 cut(s) 91, 178
BseMII CTCAG 1 cut(s) 315
BseXI GCAGC 3 cut(s) 124, 127, 319
BsgI GTGCAG 1 cut(s) 131
BshFI GGCC 1 cut(s) 163
BsnI GGCC 1 cut(s) 163
Bsp119I TTCGAA 1 cut(s) 102
Bsp143I GATC 2 cut(s) 217, 301
BspACI CCGC 1 cut(s) 160
BspANI GGCC 1 cut(s) 163
BspCNI CTCAG 1 cut(s) 316
BspMAI CTGCAG 1 cut(s) 309
BspT104I TTCGAA 1 cut(s) 102
BssECI CCNNGG 2 cut(s) 37, 81
BssMI GATC 2 cut(s) 217, 301
BssT1I CCWWGG 2 cut(s) 37, 81
Bst6I CTCTTC 1 cut(s) 222
BstBI TTCGAA 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 324
BstF5I GGATG 2 cut(s) 91, 178
BstKTI GATC 2 cut(s) 220, 304
BstMBI GATC 2 cut(s) 217, 301
BstMWI GCNNNNNNNGC 1 cut(s) 124
BstSFI CTRYAG 1 cut(s) 305
BstV1I GCAGC 3 cut(s) 124, 127, 319
BsuRI GGCC 1 cut(s) 163
BtsCI GGATG 2 cut(s) 91, 178
CviAII CATG 2 cut(s) 76, 299
CviJI RGCY 5 cut(s) 29, 118, 163, 203, 310
CviKI_1 RGCY 5 cut(s) 29, 118, 163, 203, 310
DdeI CTNAG 1 cut(s) 324
DpnI GATC 2 cut(s) 219, 303
DpnII GATC 2 cut(s) 217, 301
EaeI YGGCCR 1 cut(s) 161
Eam1104I CTCTTC 1 cut(s) 222
EarI CTCTTC 1 cut(s) 222
Eco130I CCWWGG 2 cut(s) 37, 81
Eco57I CTGAAG 1 cut(s) 207
EcoT14I CCWWGG 2 cut(s) 37, 81
ErhI CCWWGG 2 cut(s) 37, 81
FaeI CATG 2 cut(s) 79, 302
FaiI YATR 5 cut(s) 77, 143, 166, 206, 300
FatI CATG 2 cut(s) 75, 298
FbaI TGATCA 1 cut(s) 217
Fnu4HI GCNGC 4 cut(s) 113, 116, 161, 308
FokI GGATG 2 cut(s) 98, 185
Fsp4HI GCNGC 4 cut(s) 113, 116, 161, 308
GluI GCNGC 4 cut(s) 113, 116, 161, 308
HaeIII GGCC 1 cut(s) 163
Hin1II CATG 2 cut(s) 79, 302
Hpy166II GTNNAC 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 215
Hpy8I GTNNAC 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 238
HpyCH4V TGCA 6 cut(s) 112, 289, 296, 307, 346, 357
HpyF10VI GCNNNNNNNGC 1 cut(s) 124
HpyF3I CTNAG 1 cut(s) 324
Hsp92II CATG 2 cut(s) 79, 302
Ksp22I TGATCA 1 cut(s) 217
Kzo9I GATC 2 cut(s) 217, 301
Lsp1109I GCAGC 3 cut(s) 124, 127, 319
LweI GCATC 1 cut(s) 276
MalI GATC 2 cut(s) 219, 303
MboI GATC 2 cut(s) 217, 301
MboII GAAGA 3 cut(s) 28, 205, 239
MluCI AATT 2 cut(s) 318, 334
MnlI CCTC 2 cut(s) 90, 223
MseI TTAA 2 cut(s) 312, 361
MslI CAYNNNNRTG 1 cut(s) 276
MwoI GCNNNNNNNGC 1 cut(s) 124
NdeII GATC 2 cut(s) 217, 301
NlaIII CATG 2 cut(s) 79, 302
NspV TTCGAA 1 cut(s) 102
PkrI GCNGC 4 cut(s) 114, 117, 162, 309
PstI CTGCAG 1 cut(s) 309
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 2 cut(s) 312, 361
SatI GCNGC 4 cut(s) 113, 116, 161, 308
Sau3AI GATC 2 cut(s) 217, 301
SetI ASST 5 cut(s) 101, 120, 234, 294, 312
SfaNI GCATC 1 cut(s) 276
SfcI CTRYAG 1 cut(s) 305
SfuI TTCGAA 1 cut(s) 102
SmiMI CAYNNNNRTG 1 cut(s) 276
Sse9I AATT 2 cut(s) 318, 334
SsiI CCGC 1 cut(s) 160
StyI CCWWGG 2 cut(s) 37, 81
TaqI TCGA 1 cut(s) 102
TasI AATT 2 cut(s) 318, 334
TauI GCSGC 1 cut(s) 163
Tru1I TTAA 2 cut(s) 312, 361
Tru9I TTAA 2 cut(s) 312, 361
TseI GCWGC 3 cut(s) 112, 115, 307
TspDTI ATGAA 3 cut(s) 102, 221, 329
TspGWI ACGGA 1 cut(s) 185
XapI RAATTY 1 cut(s) 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.