Rmu_sc0002666.1_g000017
ERF Family

P-loop nucleoside triphosphate hydrolase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002666.1
OG0020603
Physical Location & Seq
Forward (+)
71467 .. 71851
385 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002666.1_g000017.1.cds

Sequence Viewer

Length: 288 bp
atgaccaaggatgaaagcaagaggttcgaacaagtgcagcagcttctctggcttgtgaactcggttatagcacagaatggtgggcggccatacacggatgggatatttgctgaagggaagaaagaggctatgaaacttcgtgatcaacaagaagaggttgcttctttgaaggcgtattcaaaacgagaaatatctcatttgaatgagcagatgcaccttgcacatgatctgcagcttaaacgaattactgagatggtaaattttcatctgcattttgtttgcatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AIG1

Protein Analysis

95

Amino Acids

11.13

Weight (kDa)

6.97

Isoelectric Point (pI)

46.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020603)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0229641 RchiOBHm_Chr7g0230021
rosa_multiflora Rmu_sc0002666.1_g000017 Rmu_sc0004929.1_g000005 Rmu_sc0028893.1_g000001
rosa_samantha Rh7DG404100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 85
AcoI YGGCCR 1 cut(s) 86
AcsI RAATTY 1 cut(s) 259
AcuI CTGAAG 1 cut(s) 132
AgsI TTSAA 3 cut(s) 169, 180, 202
AluBI AGCT 2 cut(s) 43, 235
AluI AGCT 2 cut(s) 43, 235
AoxI GGCC 1 cut(s) 86
ApeKI GCWGC 3 cut(s) 37, 40, 232
ApoI RAATTY 1 cut(s) 259
AsuII TTCGAA 1 cut(s) 27
BbvI GCAGC 3 cut(s) 49, 52, 244
BccI CCATC 2 cut(s) 92, 247
BcgI CGANNNNNNTGC 2 cut(s) 7, 41
BclI TGATCA 1 cut(s) 142
BfmI CTRYAG 1 cut(s) 230
BisI GCNGC 4 cut(s) 38, 41, 86, 233
BlsI GCNGC 4 cut(s) 39, 42, 87, 234
BmsI GCATC 1 cut(s) 201
Bpu14I TTCGAA 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 6
BseGI GGATG 2 cut(s) 16, 103
BseMII CTCAG 1 cut(s) 240
BseXI GCAGC 3 cut(s) 49, 52, 244
BsgI GTGCAG 1 cut(s) 56
BshFI GGCC 1 cut(s) 88
BsnI GGCC 1 cut(s) 88
Bsp119I TTCGAA 1 cut(s) 27
Bsp143I GATC 2 cut(s) 142, 226
BspACI CCGC 1 cut(s) 85
BspANI GGCC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 241
BspMAI CTGCAG 1 cut(s) 234
BspT104I TTCGAA 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 2 cut(s) 142, 226
BssT1I CCWWGG 1 cut(s) 6
Bst6I CTCTTC 1 cut(s) 147
BstBI TTCGAA 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 249
BstF5I GGATG 2 cut(s) 16, 103
BstKTI GATC 2 cut(s) 145, 229
BstMBI GATC 2 cut(s) 142, 226
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 230
BstV1I GCAGC 3 cut(s) 49, 52, 244
BsuRI GGCC 1 cut(s) 88
BtsCI GGATG 2 cut(s) 16, 103
CviAII CATG 1 cut(s) 224
CviJI RGCY 5 cut(s) 43, 52, 88, 128, 235
CviKI_1 RGCY 5 cut(s) 43, 52, 88, 128, 235
DdeI CTNAG 1 cut(s) 249
DpnI GATC 2 cut(s) 144, 228
DpnII GATC 2 cut(s) 142, 226
EaeI YGGCCR 1 cut(s) 86
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
Eco130I CCWWGG 1 cut(s) 6
Eco57I CTGAAG 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 1 cut(s) 227
FaiI YATR 4 cut(s) 68, 91, 131, 225
FatI CATG 1 cut(s) 223
FbaI TGATCA 1 cut(s) 142
Fnu4HI GCNGC 4 cut(s) 38, 41, 86, 233
FokI GGATG 2 cut(s) 23, 110
Fsp4HI GCNGC 4 cut(s) 38, 41, 86, 233
GluI GCNGC 4 cut(s) 38, 41, 86, 233
HaeIII GGCC 1 cut(s) 88
Hin1II CATG 1 cut(s) 227
Hpy166II GTNNAC 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 58
HpyAV CCTTC 2 cut(s) 107, 163
HpyCH4V TGCA 6 cut(s) 37, 214, 221, 232, 271, 282
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 249
Hsp92II CATG 1 cut(s) 227
Ksp22I TGATCA 1 cut(s) 142
Kzo9I GATC 2 cut(s) 142, 226
LpnPI CCDG 1 cut(s) 34
Lsp1109I GCAGC 3 cut(s) 49, 52, 244
LweI GCATC 1 cut(s) 201
MalI GATC 2 cut(s) 144, 228
MboI GATC 2 cut(s) 142, 226
MboII GAAGA 2 cut(s) 130, 164
MluCI AATT 2 cut(s) 243, 259
MnlI CCTC 3 cut(s) 15, 118, 148
MseI TTAA 2 cut(s) 237, 286
MslI CAYNNNNRTG 1 cut(s) 201
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 2 cut(s) 142, 226
NlaIII CATG 1 cut(s) 227
NspV TTCGAA 1 cut(s) 27
PkrI GCNGC 4 cut(s) 39, 42, 87, 234
PstI CTGCAG 1 cut(s) 234
RseI CAYNNNNRTG 1 cut(s) 201
SaqAI TTAA 2 cut(s) 237, 286
SatI GCNGC 4 cut(s) 38, 41, 86, 233
Sau3AI GATC 2 cut(s) 142, 226
SetI ASST 5 cut(s) 26, 45, 159, 219, 237
SfaNI GCATC 1 cut(s) 201
SfcI CTRYAG 1 cut(s) 230
SfuI TTCGAA 1 cut(s) 27
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 2 cut(s) 243, 259
SsiI CCGC 1 cut(s) 85
StyI CCWWGG 1 cut(s) 6
TaqI TCGA 1 cut(s) 27
TasI AATT 2 cut(s) 243, 259
TauI GCSGC 1 cut(s) 88
Tru1I TTAA 2 cut(s) 237, 286
Tru9I TTAA 2 cut(s) 237, 286
TseI GCWGC 3 cut(s) 37, 40, 232
TspDTI ATGAA 3 cut(s) 27, 146, 254
TspGWI ACGGA 1 cut(s) 110
XapI RAATTY 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.