Rmu_sc0004929.1_g000005
ERF Family

P-loop nucleoside triphosphate hydrolase superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004929.1
OG0020603
Physical Location & Seq
Forward (+)
15240 .. 15561
322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004929.1_g000005.1.cds

Sequence Viewer

Length: 225 bp
atgaccaaggatgaaagcaagaggttcgaacaagtgcagcagcttctctcgcttgtgaactcggttatagcacagaatggtgggcggccatacacggatgggatatttaagaaaggggctatgaaacttcatgatcaacaagaagagattgcttctttgaaggagtattcaaaacaagaaatatctcatttgaatgagcagatgcaccttgcacatgatctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AIG1

Protein Analysis

74

Amino Acids

8.51

Weight (kDa)

6.03

Isoelectric Point (pI)

43.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020603)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0229641 RchiOBHm_Chr7g0230021
rosa_multiflora Rmu_sc0002666.1_g000017 Rmu_sc0004929.1_g000005 Rmu_sc0028893.1_g000001
rosa_samantha Rh7DG404100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 85
AcoI YGGCCR 1 cut(s) 86
AgsI TTSAA 3 cut(s) 160, 171, 193
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AoxI GGCC 1 cut(s) 86
ApeKI GCWGC 2 cut(s) 37, 40
AsuII TTCGAA 1 cut(s) 27
BbvI GCAGC 2 cut(s) 49, 52
BccI CCATC 1 cut(s) 92
BcgI CGANNNNNNTGC 2 cut(s) 7, 41
BclI TGATCA 1 cut(s) 133
BfmI CTRYAG 1 cut(s) 221
BisI GCNGC 3 cut(s) 38, 41, 86
BlsI GCNGC 3 cut(s) 39, 42, 87
BmsI GCATC 1 cut(s) 192
Bpu14I TTCGAA 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 6
BseGI GGATG 2 cut(s) 16, 103
BseXI GCAGC 2 cut(s) 49, 52
BsgI GTGCAG 1 cut(s) 56
BshFI GGCC 1 cut(s) 88
BsnI GGCC 1 cut(s) 88
Bsp119I TTCGAA 1 cut(s) 27
Bsp143I GATC 2 cut(s) 133, 217
BspACI CCGC 1 cut(s) 85
BspANI GGCC 1 cut(s) 88
BspHI TCATGA 1 cut(s) 130
BspT104I TTCGAA 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 2 cut(s) 133, 217
BssT1I CCWWGG 1 cut(s) 6
Bst6I CTCTTC 1 cut(s) 138
BstBI TTCGAA 1 cut(s) 27
BstF5I GGATG 2 cut(s) 16, 103
BstKTI GATC 2 cut(s) 136, 220
BstMBI GATC 2 cut(s) 133, 217
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstSFI CTRYAG 1 cut(s) 221
BstV1I GCAGC 2 cut(s) 49, 52
BsuRI GGCC 1 cut(s) 88
BtsCI GGATG 2 cut(s) 16, 103
CciI TCATGA 1 cut(s) 130
CviAII CATG 2 cut(s) 131, 215
CviJI RGCY 3 cut(s) 43, 88, 119
CviKI_1 RGCY 3 cut(s) 43, 88, 119
DpnI GATC 2 cut(s) 135, 219
DpnII GATC 2 cut(s) 133, 217
EaeI YGGCCR 1 cut(s) 86
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco130I CCWWGG 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 2 cut(s) 134, 218
FaiI YATR 5 cut(s) 68, 91, 122, 132, 216
FatI CATG 2 cut(s) 130, 214
FbaI TGATCA 1 cut(s) 133
Fnu4HI GCNGC 3 cut(s) 38, 41, 86
FokI GGATG 2 cut(s) 23, 110
Fsp4HI GCNGC 3 cut(s) 38, 41, 86
GluI GCNGC 3 cut(s) 38, 41, 86
HaeIII GGCC 1 cut(s) 88
Hin1II CATG 2 cut(s) 134, 218
Hpy166II GTNNAC 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 154
HpyCH4V TGCA 3 cut(s) 37, 205, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
Hsp92II CATG 2 cut(s) 134, 218
Ksp22I TGATCA 1 cut(s) 133
Kzo9I GATC 2 cut(s) 133, 217
Lsp1109I GCAGC 2 cut(s) 49, 52
LweI GCATC 1 cut(s) 192
MalI GATC 2 cut(s) 135, 219
MboI GATC 2 cut(s) 133, 217
MboII GAAGA 1 cut(s) 155
MnlI CCTC 1 cut(s) 15
MseI TTAA 1 cut(s) 108
MslI CAYNNNNRTG 1 cut(s) 192
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 2 cut(s) 133, 217
NlaIII CATG 2 cut(s) 134, 218
NspV TTCGAA 1 cut(s) 27
PagI TCATGA 1 cut(s) 130
PkrI GCNGC 3 cut(s) 39, 42, 87
RseI CAYNNNNRTG 1 cut(s) 192
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 3 cut(s) 38, 41, 86
Sau3AI GATC 2 cut(s) 133, 217
SetI ASST 3 cut(s) 26, 45, 210
SfaNI GCATC 1 cut(s) 192
SfcI CTRYAG 1 cut(s) 221
SfuI TTCGAA 1 cut(s) 27
SmiMI CAYNNNNRTG 1 cut(s) 192
SsiI CCGC 1 cut(s) 85
StyI CCWWGG 1 cut(s) 6
TaqI TCGA 1 cut(s) 27
TauI GCSGC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TseI GCWGC 2 cut(s) 37, 40
TspDTI ATGAA 3 cut(s) 27, 119, 137
TspGWI ACGGA 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.