RLG00000012916

ADP binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0019430
Physical Location & Seq
Forward (+)
23834313 .. 23835281
969 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000012916

Sequence Viewer

Length: 678 bp
ATGGATTCCAGGAATTGTCTTGTAGTATTGGTTGATGTTTGGAAAATGCTTGATATGGAGGCCACTGAAATCCCTCATCTCCAAAGATTTAAGATCTCTACAACAAAGATGGATGATATGTTATCGGATCGAAATCCTTATGAGAACTATTTGAGAATTGATCTCGATGCAGACTTTCTTGTGGGTAGCAGAATCAATATGCTGTTAAAGAGAACCAACACTCTAGTGTTAAACATGTTTAGATTGAGGGATGCTCTCAATCTCTTAGATACAGAGTGTTGTGTAAACTTGAAGTATCTTGAGCTGAATCACTGCCATGCTCTGGAACATGTGATTGACATAACAGATATAGGTCCATGCATTGTCTTTCCTGTATTGGAGTCATTGACGATCCAGGGTGCCGAAATGCTAAAGGAGATCTGTCATGGTGAGGATCTGCTTCTAGTGGGGTCATGCAAGCAACTAAACAAGTTGTCTCTGTCAAATTTACCTTCATTGACAAATTTTTGGAAGATAGAGTCTCACCCTGAATACCAGAGAAATCTAAGAAGTGTTGAAGTGTGTTCATGTGAAAGATCAAAGTCTCTGTTCCAATTGCCGGTTGCCAGCAATCTGAAGGAGCTTGAAACGGTTGACATACAAAACTGCAGGGACTGGAAGAGATTTTTGTTGGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0007154 GO:0007165 GO:0008150 GO:0009987 GO:0016020 GO:0023052 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

226

Amino Acids

26.04

Weight (kDa)

5.4

Isoelectric Point (pI)

39.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_RPS2 PF23247 90 - 217 3.9e-17 Plant disease resistance protein RPS2-like, leucine-rich repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019430)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0282061
rosa_laevigata RLG00000012916
rosa_multiflora Rmu_sc0001700.1_g000010 Rmu_sc0001700.1_g000017
rosa_rugosa Rorug03G0141700 Rorug06G0145100
rosa_samantha Rh6BG261400 Rh6CG260300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 398
AccB7I CCANNNNNTGG 1 cut(s) 322
AclWI GGATC 3 cut(s) 135, 385, 441
AcsI RAATTY 2 cut(s) 484, 502
AcuI CTGAAG 1 cut(s) 635
AfiI CCNNNNNNNGG 2 cut(s) 322, 598
AflIII ACRYGT 2 cut(s) 234, 328
AgsI TTSAA 3 cut(s) 292, 557, 626
AjnI CCWGG 2 cut(s) 8, 393
AleI CACNNNNGTG 1 cut(s) 224
AluBI AGCT 2 cut(s) 304, 622
AluI AGCT 2 cut(s) 304, 622
Alw26I GTCTC 3 cut(s) 480, 525, 588
AlwI GGATC 3 cut(s) 135, 385, 441
AlwNI CAGNNNCTG 1 cut(s) 654
AoxI GGCC 2 cut(s) 60, 672
ApoI RAATTY 2 cut(s) 484, 502
AspS9I GGNCC 1 cut(s) 353
AsuHPI GGTGA 2 cut(s) 440, 515
AvaII GGWCC 1 cut(s) 353
BanI GGYRCC 1 cut(s) 398
BccI CCATC 1 cut(s) 103
BciT130I CCWGG 2 cut(s) 10, 395
BcoDI GTCTC 3 cut(s) 480, 525, 588
BfaI CTAG 3 cut(s) 224, 443, 676
BfmI CTRYAG 1 cut(s) 646
BglII AGATCT 2 cut(s) 93, 417
Bme1390I CCNGG 2 cut(s) 10, 395
Bme18I GGWCC 1 cut(s) 353
BmgT120I GGNCC 1 cut(s) 353
BmiI GGNNCC 1 cut(s) 400
BmrFI CCNGG 2 cut(s) 10, 395
BmsI GCATC 2 cut(s) 157, 241
BplI GAGNNNNNCTC 2 cut(s) 238, 270
BpuEI CTTGAG 1 cut(s) 320
BsaBI GATNNNNATC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 394
Bsc4I CCNNNNNNNGG 2 cut(s) 322, 598
Bse118I RCCGGY 1 cut(s) 598
Bse1I ACTGG 1 cut(s) 659
Bse8I GATNNNNATC 1 cut(s) 132
BseBI CCWGG 2 cut(s) 10, 395
BseDI CCNNGG 1 cut(s) 394
BseGI GGATG 2 cut(s) 118, 256
BseJI GATNNNNATC 1 cut(s) 132
BseLI CCNNNNNNNGG 2 cut(s) 322, 598
BseNI ACTGG 1 cut(s) 659
BshFI GGCC 2 cut(s) 62, 674
BshNI GGYRCC 1 cut(s) 398
BsiSI CCGG 1 cut(s) 599
BslFI GGGAC 1 cut(s) 665
BslI CCNNNNNNNGG 2 cut(s) 322, 598
BsmAI GTCTC 3 cut(s) 480, 525, 588
BsmFI GGGAC 1 cut(s) 665
BsnI GGCC 2 cut(s) 62, 674
Bsp143I GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
BspANI GGCC 2 cut(s) 62, 674
BspLI GGNNCC 1 cut(s) 400
BspMAI CTGCAG 1 cut(s) 650
BspPI GGATC 3 cut(s) 135, 385, 441
BspT107I GGYRCC 1 cut(s) 398
BsrFI RCCGGY 1 cut(s) 598
BsrI ACTGG 1 cut(s) 659
BssAI RCCGGY 1 cut(s) 598
BssECI CCNNGG 1 cut(s) 394
BssMI GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
Bst2UI CCWGG 2 cut(s) 10, 395
Bst4CI ACNGT 1 cut(s) 631
Bst6I CTCTTC 1 cut(s) 653
BstC8I GCNNGC 2 cut(s) 458, 607
BstDEI CTNAG 2 cut(s) 265, 545
BstF5I GGATG 2 cut(s) 118, 256
BstKTI GATC 7 cut(s) 96, 130, 163, 393, 420, 436, 578
BstMAI GTCTC 3 cut(s) 480, 525, 588
BstMBI GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
BstNI CCWGG 2 cut(s) 10, 395
BstNSI RCATGY 2 cut(s) 238, 332
BstSCI CCNGG 2 cut(s) 8, 393
BstSFI CTRYAG 1 cut(s) 646
BstX2I RGATCY 3 cut(s) 93, 417, 433
BstYI RGATCY 3 cut(s) 93, 417, 433
BsuRI GGCC 2 cut(s) 62, 674
BtsCI GGATG 2 cut(s) 118, 256
BtsI GCAGTG 1 cut(s) 310
BtsIMutI CAGTG 2 cut(s) 63, 310
Cac8I GCNNGC 2 cut(s) 458, 607
CaiI CAGNNNCTG 1 cut(s) 654
Cfr10I RCCGGY 1 cut(s) 598
Cfr13I GGNCC 1 cut(s) 353
CviAII CATG 7 cut(s) 235, 317, 329, 357, 425, 453, 567
CviJI RGCY 4 cut(s) 62, 304, 622, 674
CviKI_1 RGCY 4 cut(s) 62, 304, 622, 674
DdeI CTNAG 2 cut(s) 265, 545
DpnI GATC 7 cut(s) 95, 129, 162, 392, 419, 435, 577
DpnII GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
Eam1104I CTCTTC 1 cut(s) 653
EarI CTCTTC 1 cut(s) 653
Eco47I GGWCC 1 cut(s) 353
Eco57I CTGAAG 1 cut(s) 635
EcoRII CCWGG 2 cut(s) 8, 393
EcoT22I ATGCAT 1 cut(s) 362
FaeI CATG 7 cut(s) 238, 320, 332, 360, 428, 456, 570
FaqI GGGAC 1 cut(s) 665
FatI CATG 7 cut(s) 234, 316, 328, 356, 424, 452, 566
FokI GGATG 2 cut(s) 125, 263
FspBI CTAG 3 cut(s) 224, 443, 676
HaeIII GGCC 2 cut(s) 62, 674
HapII CCGG 1 cut(s) 599
Hin1II CATG 7 cut(s) 238, 320, 332, 360, 428, 456, 570
HincII GTYRAC 1 cut(s) 634
HindII GTYRAC 1 cut(s) 634
HinfI GANTC 5 cut(s) 5, 192, 307, 380, 518
HpaII CCGG 1 cut(s) 599
HphI GGTGA 2 cut(s) 440, 515
Hpy166II GTNNAC 2 cut(s) 286, 634
Hpy188I TCNGA 2 cut(s) 127, 615
Hpy188III TCNNGA 3 cut(s) 164, 299, 323
Hpy8I GTNNAC 2 cut(s) 286, 634
HpyAV CCTTC 2 cut(s) 501, 610
HpyCH4III ACNGT 1 cut(s) 631
HpyCH4V TGCA 4 cut(s) 170, 360, 456, 648
HpyF3I CTNAG 2 cut(s) 265, 545
Hsp92II CATG 7 cut(s) 238, 320, 332, 360, 428, 456, 570
Kzo9I GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
LmnI GCTCC 1 cut(s) 619
LweI GCATC 2 cut(s) 157, 241
MaeI CTAG 3 cut(s) 224, 443, 676
MalI GATC 7 cut(s) 95, 129, 162, 392, 419, 435, 577
MboI GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
MboII GAAGA 2 cut(s) 523, 670
MfeI CAATTG 1 cut(s) 593
MflI RGATCY 3 cut(s) 93, 417, 433
MluCI AATT 5 cut(s) 13, 156, 484, 502, 593
MlyI GAGTC 2 cut(s) 389, 527
MnlI CCTC 4 cut(s) 52, 84, 240, 424
Mph1103I ATGCAT 1 cut(s) 362
MseI TTAA 3 cut(s) 90, 206, 230
MslI CAYNNNNRTG 2 cut(s) 224, 315
MspI CCGG 1 cut(s) 599
MspR9I CCNGG 2 cut(s) 10, 395
MunI CAATTG 1 cut(s) 593
MvaI CCWGG 2 cut(s) 10, 395
NdeII GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
NlaIII CATG 7 cut(s) 238, 320, 332, 360, 428, 456, 570
NlaIV GGNNCC 1 cut(s) 400
NsiI ATGCAT 1 cut(s) 362
NspI RCATGY 2 cut(s) 238, 332
OliI CACNNNNGTG 1 cut(s) 224
PciI ACATGT 2 cut(s) 234, 328
PfeI GAWTC 3 cut(s) 5, 192, 307
PflMI CCANNNNNTGG 1 cut(s) 322
PfoI TCCNGGA 1 cut(s) 8
PleI GAGTC 2 cut(s) 388, 526
PpsI GAGTC 2 cut(s) 388, 526
PscI ACATGT 2 cut(s) 234, 328
Psp6I CCWGG 2 cut(s) 8, 393
PspGI CCWGG 2 cut(s) 8, 393
PspN4I GGNNCC 1 cut(s) 400
PspPI GGNCC 1 cut(s) 353
PstI CTGCAG 1 cut(s) 650
PstNI CAGNNNCTG 1 cut(s) 654
PsuI RGATCY 3 cut(s) 93, 417, 433
RseI CAYNNNNRTG 2 cut(s) 224, 315
SaqAI TTAA 3 cut(s) 90, 206, 230
Sau3AI GATC 7 cut(s) 93, 127, 160, 390, 417, 433, 575
Sau96I GGNCC 1 cut(s) 353
SchI GAGTC 2 cut(s) 389, 527
ScrFI CCNGG 2 cut(s) 10, 395
SetI ASST 4 cut(s) 306, 355, 493, 624
SfaNI GCATC 2 cut(s) 157, 241
SfcI CTRYAG 1 cut(s) 646
SinI GGWCC 1 cut(s) 353
SmiMI CAYNNNNRTG 2 cut(s) 224, 315
SmlI CTYRAG 1 cut(s) 299
SmoI CTYRAG 1 cut(s) 299
Sse9I AATT 5 cut(s) 13, 156, 484, 502, 593
SspMI CTAG 3 cut(s) 224, 443, 676
StyD4I CCNGG 2 cut(s) 8, 393
TaaI ACNGT 1 cut(s) 631
TaqI TCGA 2 cut(s) 130, 165
TasI AATT 5 cut(s) 13, 156, 484, 502, 593
TfiI GAWTC 3 cut(s) 5, 192, 307
Tru1I TTAA 3 cut(s) 90, 206, 230
Tru9I TTAA 3 cut(s) 90, 206, 230
TscAI CASTG 2 cut(s) 70, 317
TspDTI ATGAA 2 cut(s) 483, 555
TspRI CASTG 2 cut(s) 70, 317
Van91I CCANNNNNTGG 1 cut(s) 322
VpaK11BI GGWCC 1 cut(s) 353
XapI RAATTY 2 cut(s) 484, 502
XceI RCATGY 2 cut(s) 238, 332
XspI CTAG 3 cut(s) 224, 443, 676
Zsp2I ATGCAT 1 cut(s) 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.