Rmu_sc0001700.1_g000017

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001700.1
OG0019430
Physical Location & Seq
Reverse (-)
86367 .. 86918
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001700.1_g000017.1.cds

Sequence Viewer

Length: 552 bp
atgcatggtatgttatcggatcgaaatccttgtgagaactatatgagaattgatcttgatgcagactctcttgtgggtagcagaatcaatatgctgttaaagagaaccaacactctagtgttaaacatgtttagattgagggacgctctcaatctcttagatacagagtgttgtgtaaacttgaagtatcttaagcagaatcactgccatgctctggaatatgtgattgcatgcattgtccttcctgtattggagtcattgacgatccaaggtgccgaaatgctaaaggagatttgtcatggtgaggatctgcttccagtggggtcacgcaaacaactaagcaagttgtctctgtcaaatttaccttcactgacaaatttttggaagatagaatctcaacctgaatacctgaaaaatctaagaagtgttgaagtgtgttcatgtgaaagattgaagtctctgttccaattgccgggtgctagtaatctgaaggagcttgaaacggttgacatacaaaactgcagggactggaagagatttttattggcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

183

Amino Acids

20.98

Weight (kDa)

6.88

Isoelectric Point (pI)

43.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019430)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0282061
rosa_laevigata RLG00000012916
rosa_multiflora Rmu_sc0001700.1_g000010 Rmu_sc0001700.1_g000017
rosa_rugosa Rorug03G0141700 Rorug06G0145100
rosa_samantha Rh6BG261400 Rh6CG260300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 272
AccB7I CCANNNNNTGG 1 cut(s) 214
AclWI GGATC 3 cut(s) 27, 259, 315
AcsI RAATTY 2 cut(s) 358, 376
AcuI CTGAAG 1 cut(s) 509
AfiI CCNNNNNNNGG 2 cut(s) 214, 472
AflII CTTAAG 1 cut(s) 191
AflIII ACRYGT 1 cut(s) 126
AgsI TTSAA 4 cut(s) 184, 431, 454, 500
AleI CACNNNNGTG 1 cut(s) 116
AluBI AGCT 1 cut(s) 496
AluI AGCT 1 cut(s) 496
Alw26I GTCTC 2 cut(s) 354, 462
AlwI GGATC 3 cut(s) 27, 259, 315
AlwNI CAGNNNCTG 1 cut(s) 528
AoxI GGCC 1 cut(s) 546
ApoI RAATTY 2 cut(s) 358, 376
AsuC2I CCSGG 1 cut(s) 474
AsuHPI GGTGA 1 cut(s) 314
BanI GGYRCC 1 cut(s) 272
BcnI CCSGG 1 cut(s) 474
BcoDI GTCTC 2 cut(s) 354, 462
BfaI CTAG 3 cut(s) 116, 480, 550
BfmI CTRYAG 1 cut(s) 520
BfrI CTTAAG 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 474
BmiI GGNNCC 1 cut(s) 274
BmrFI CCNGG 1 cut(s) 474
BmsI GCATC 1 cut(s) 49
BplI GAGNNNNNCTC 2 cut(s) 130, 162
BpuMI CCSGG 1 cut(s) 474
BsaBI GATNNNNATC 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 268
Bsc4I CCNNNNNNNGG 2 cut(s) 214, 472
Bse1I ACTGG 2 cut(s) 317, 533
Bse8I GATNNNNATC 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 268
BseJI GATNNNNATC 1 cut(s) 24
BseLI CCNNNNNNNGG 2 cut(s) 214, 472
BseNI ACTGG 2 cut(s) 317, 533
BshFI GGCC 1 cut(s) 548
BshNI GGYRCC 1 cut(s) 272
BsiSI CCGG 1 cut(s) 473
BslFI GGGAC 2 cut(s) 155, 539
BslI CCNNNNNNNGG 2 cut(s) 214, 472
BsmAI GTCTC 2 cut(s) 354, 462
BsmFI GGGAC 2 cut(s) 155, 539
BsnI GGCC 1 cut(s) 548
Bsp143I GATC 4 cut(s) 19, 52, 264, 307
BspANI GGCC 1 cut(s) 548
BspLI GGNNCC 1 cut(s) 274
BspMAI CTGCAG 1 cut(s) 524
BspPI GGATC 3 cut(s) 27, 259, 315
BspT107I GGYRCC 1 cut(s) 272
BspTI CTTAAG 1 cut(s) 191
BsrI ACTGG 2 cut(s) 317, 533
BssECI CCNNGG 1 cut(s) 268
BssMI GATC 4 cut(s) 19, 52, 264, 307
BssT1I CCWWGG 1 cut(s) 268
Bst4CI ACNGT 1 cut(s) 505
Bst6I CTCTTC 1 cut(s) 527
BstAFI CTTAAG 1 cut(s) 191
BstC8I GCNNGC 1 cut(s) 232
BstDEI CTNAG 3 cut(s) 157, 338, 419
BstKTI GATC 4 cut(s) 22, 55, 267, 310
BstMAI GTCTC 2 cut(s) 354, 462
BstMBI GATC 4 cut(s) 19, 52, 264, 307
BstNSI RCATGY 2 cut(s) 130, 234
BstSCI CCNGG 1 cut(s) 472
BstSFI CTRYAG 1 cut(s) 520
BstX2I RGATCY 1 cut(s) 307
BstYI RGATCY 1 cut(s) 307
BsuRI GGCC 1 cut(s) 548
BtsI GCAGTG 1 cut(s) 202
BtsIMutI CAGTG 3 cut(s) 202, 324, 368
Cac8I GCNNGC 1 cut(s) 232
CaiI CAGNNNCTG 1 cut(s) 528
CseI GACGC 1 cut(s) 152
CviAII CATG 6 cut(s) 5, 127, 209, 231, 299, 441
CviJI RGCY 2 cut(s) 496, 548
CviKI_1 RGCY 2 cut(s) 496, 548
DdeI CTNAG 3 cut(s) 157, 338, 419
DpnI GATC 4 cut(s) 21, 54, 266, 309
DpnII GATC 4 cut(s) 19, 52, 264, 307
Eam1104I CTCTTC 1 cut(s) 527
EarI CTCTTC 1 cut(s) 527
Eco130I CCWWGG 1 cut(s) 268
Eco57I CTGAAG 1 cut(s) 509
EcoT14I CCWWGG 1 cut(s) 268
EcoT22I ATGCAT 2 cut(s) 6, 236
ErhI CCWWGG 1 cut(s) 268
FaeI CATG 6 cut(s) 8, 130, 212, 234, 302, 444
FaqI GGGAC 2 cut(s) 155, 539
FatI CATG 6 cut(s) 4, 126, 208, 230, 298, 440
FspBI CTAG 3 cut(s) 116, 480, 550
HaeIII GGCC 1 cut(s) 548
HapII CCGG 1 cut(s) 473
HgaI GACGC 1 cut(s) 152
Hin1II CATG 6 cut(s) 8, 130, 212, 234, 302, 444
HincII GTYRAC 1 cut(s) 508
HindII GTYRAC 1 cut(s) 508
HinfI GANTC 5 cut(s) 65, 84, 199, 254, 392
HpaII CCGG 1 cut(s) 473
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 2 cut(s) 178, 508
Hpy188I TCNGA 2 cut(s) 19, 489
Hpy188III TCNNGA 2 cut(s) 56, 215
Hpy8I GTNNAC 2 cut(s) 178, 508
HpyAV CCTTC 3 cut(s) 251, 375, 484
HpyCH4III ACNGT 1 cut(s) 505
HpyCH4V TGCA 5 cut(s) 4, 62, 230, 234, 522
HpyF3I CTNAG 3 cut(s) 157, 338, 419
Hsp92II CATG 6 cut(s) 8, 130, 212, 234, 302, 444
Kzo9I GATC 4 cut(s) 19, 52, 264, 307
LmnI GCTCC 1 cut(s) 493
LpnPI CCDG 8 cut(s) 200, 258, 330, 414, 422, 486, 508, 514
LweI GCATC 1 cut(s) 49
MaeI CTAG 3 cut(s) 116, 480, 550
MaeIII GTNAC 1 cut(s) 324
MalI GATC 4 cut(s) 21, 54, 266, 309
MboI GATC 4 cut(s) 19, 52, 264, 307
MboII GAAGA 2 cut(s) 397, 544
MfeI CAATTG 1 cut(s) 467
MflI RGATCY 1 cut(s) 307
MluCI AATT 4 cut(s) 48, 358, 376, 467
MlyI GAGTC 2 cut(s) 59, 263
MnlI CCTC 2 cut(s) 132, 298
Mph1103I ATGCAT 2 cut(s) 6, 236
MseI TTAA 3 cut(s) 98, 122, 192
MslI CAYNNNNRTG 2 cut(s) 116, 207
MspCI CTTAAG 1 cut(s) 191
MspI CCGG 1 cut(s) 473
MspR9I CCNGG 1 cut(s) 474
MunI CAATTG 1 cut(s) 467
NciI CCSGG 1 cut(s) 474
NdeII GATC 4 cut(s) 19, 52, 264, 307
NlaIII CATG 6 cut(s) 8, 130, 212, 234, 302, 444
NlaIV GGNNCC 1 cut(s) 274
NmuCI GTSAC 1 cut(s) 324
NsiI ATGCAT 2 cut(s) 6, 236
NspI RCATGY 2 cut(s) 130, 234
OliI CACNNNNGTG 1 cut(s) 116
PaeI GCATGC 1 cut(s) 234
PciI ACATGT 1 cut(s) 126
PfeI GAWTC 3 cut(s) 84, 199, 392
PflMI CCANNNNNTGG 1 cut(s) 214
PleI GAGTC 2 cut(s) 59, 262
PpsI GAGTC 2 cut(s) 59, 262
PscI ACATGT 1 cut(s) 126
PspN4I GGNNCC 1 cut(s) 274
PstI CTGCAG 1 cut(s) 524
PstNI CAGNNNCTG 1 cut(s) 528
PsuI RGATCY 1 cut(s) 307
RseI CAYNNNNRTG 2 cut(s) 116, 207
SaqAI TTAA 3 cut(s) 98, 122, 192
Sau3AI GATC 4 cut(s) 19, 52, 264, 307
SchI GAGTC 2 cut(s) 59, 263
ScrFI CCNGG 1 cut(s) 474
SetI ASST 5 cut(s) 274, 367, 403, 411, 498
SfaNI GCATC 1 cut(s) 49
SfcI CTRYAG 1 cut(s) 520
SmiMI CAYNNNNRTG 2 cut(s) 116, 207
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
SphI GCATGC 1 cut(s) 234
Sse9I AATT 4 cut(s) 48, 358, 376, 467
SspMI CTAG 3 cut(s) 116, 480, 550
StyD4I CCNGG 1 cut(s) 472
StyI CCWWGG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 505
TaqI TCGA 1 cut(s) 22
TasI AATT 4 cut(s) 48, 358, 376, 467
TfiI GAWTC 3 cut(s) 84, 199, 392
Tru1I TTAA 3 cut(s) 98, 122, 192
Tru9I TTAA 3 cut(s) 98, 122, 192
TscAI CASTG 3 cut(s) 209, 324, 375
TseFI GTSAC 1 cut(s) 324
Tsp45I GTSAC 1 cut(s) 324
TspDTI ATGAA 1 cut(s) 429
TspRI CASTG 3 cut(s) 209, 324, 375
Van91I CCANNNNNTGG 1 cut(s) 214
Vha464I CTTAAG 1 cut(s) 191
XapI RAATTY 2 cut(s) 358, 376
XceI RCATGY 2 cut(s) 130, 234
XspI CTAG 3 cut(s) 116, 480, 550
Zsp2I ATGCAT 2 cut(s) 6, 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.