Rmu_co8009242.1_g000001

ABC transporter G family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8009242.1
Physical Location & Seq
Reverse (-)
1 .. 481
481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8009242.1_g000001.1.cds

Sequence Viewer

Length: 246 bp
ctgagcattgcactcgaaatactcacaaagccaaggttgttgtttctcgatgagcctaccagtggcctcgacagtgctgcagctttcttcgtagttcaaaccctcagatacattgctgaagatggcagaactgtcatttcttcgattcatcagcccagtagtgaagtgtttgctttgtttgatgatcttgttctgctttctagtggccaaacagtttattctggtcaagcaaaaatggcagtagag

Protein Analysis

82

Amino Acids

8.89

Weight (kDa)

4.55

Isoelectric Point (pI)

42.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019912)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0457431
rosa_laevigata RLG00000025230
rosa_multiflora Rmu_co8009242.1_g000001
rosa_samantha Rh3AG080600 Rh3BG082500 Rh3CG082700 Rh3DG084200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 205
AcuI CTGAAG 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 62
AgsI TTSAA 1 cut(s) 98
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AoxI GGCC 2 cut(s) 64, 205
ApeKI GCWGC 2 cut(s) 77, 80
BalI TGGCCA 1 cut(s) 207
BbvI GCAGC 2 cut(s) 64, 92
BccI CCATC 1 cut(s) 116
BcgI CGANNNNNNTGC 3 cut(s) 29, 59, 93
BfaI CTAG 1 cut(s) 201
BfmI CTRYAG 1 cut(s) 78
BisI GCNGC 2 cut(s) 78, 81
BlsI GCNGC 2 cut(s) 79, 82
BmrI ACTGGG 1 cut(s) 150
BmuI ACTGGG 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse1I ACTGG 2 cut(s) 60, 156
Bse3DI GCAATG 2 cut(s) 6, 111
BseDI CCNNGG 1 cut(s) 32
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMI GCAATG 2 cut(s) 6, 111
BseMII CTCAG 1 cut(s) 118
BseNI ACTGG 2 cut(s) 60, 156
BseXI GCAGC 2 cut(s) 64, 92
BshFI GGCC 2 cut(s) 66, 207
BslI CCNNNNNNNGG 1 cut(s) 62
BsnI GGCC 2 cut(s) 66, 207
Bsp143I GATC 1 cut(s) 184
BspANI GGCC 2 cut(s) 66, 207
BspCNI CTCAG 1 cut(s) 117
BspMAI CTGCAG 1 cut(s) 82
BsrDI GCAATG 2 cut(s) 6, 111
BsrI ACTGG 2 cut(s) 60, 156
BssECI CCNNGG 1 cut(s) 32
BssMI GATC 1 cut(s) 184
BssT1I CCWWGG 1 cut(s) 32
Bst4CI ACNGT 3 cut(s) 74, 133, 214
BstDEI CTNAG 2 cut(s) 2, 104
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstSFI CTRYAG 1 cut(s) 78
BstV1I GCAGC 2 cut(s) 64, 92
BsuRI GGCC 2 cut(s) 66, 207
BtsIMutI CAGTG 2 cut(s) 67, 79
CviJI RGCY 6 cut(s) 31, 55, 66, 83, 154, 207
CviKI_1 RGCY 6 cut(s) 31, 55, 66, 83, 154, 207
DdeI CTNAG 2 cut(s) 2, 104
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
EaeI YGGCCR 1 cut(s) 205
Eco130I CCWWGG 1 cut(s) 32
Eco57I CTGAAG 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 32
ErhI CCWWGG 1 cut(s) 32
Fnu4HI GCNGC 2 cut(s) 78, 81
Fsp4HI GCNGC 2 cut(s) 78, 81
FspBI CTAG 1 cut(s) 201
GluI GCNGC 2 cut(s) 78, 81
HaeIII GGCC 2 cut(s) 66, 207
HinfI GANTC 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 107
Hpy188III TCNNGA 1 cut(s) 47
HpyCH4III ACNGT 3 cut(s) 74, 133, 214
HpyCH4V TGCA 2 cut(s) 11, 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 2 cut(s) 2, 104
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 3 cut(s) 73, 169, 207
Lsp1109I GCAGC 2 cut(s) 64, 92
MaeI CTAG 1 cut(s) 201
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 3 cut(s) 79, 131, 132
MlsI TGGCCA 1 cut(s) 207
MluNI TGGCCA 1 cut(s) 207
MnlI CCTC 2 cut(s) 77, 113
Mox20I TGGCCA 1 cut(s) 207
MscI TGGCCA 1 cut(s) 207
Msp20I TGGCCA 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 236
NdeII GATC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 145
PkrI GCNGC 2 cut(s) 79, 82
PstI CTGCAG 1 cut(s) 82
SatI GCNGC 2 cut(s) 78, 81
Sau3AI GATC 1 cut(s) 184
SetI ASST 2 cut(s) 38, 85
SfcI CTRYAG 1 cut(s) 78
SspMI CTAG 1 cut(s) 201
StyI CCWWGG 1 cut(s) 32
TaaI ACNGT 3 cut(s) 74, 133, 214
TaqI TCGA 4 cut(s) 15, 48, 69, 143
TfiI GAWTC 1 cut(s) 145
TscAI CASTG 2 cut(s) 67, 79
TseI GCWGC 2 cut(s) 77, 80
TspDTI ATGAA 1 cut(s) 137
TspRI CASTG 2 cut(s) 67, 79
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.