Rmu_co8015760.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8015760.1
Physical Location & Seq
Reverse (-)
47 .. 508
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8015760.1_g000001.1.cds

Sequence Viewer

Length: 462 bp
atgcaagagggaggagttcaggctaatgaagtgactttgagttgtgtactttctgcatgcagccatagtggttctgtagaaaagggtttagagatattcaggtccatgaaagagtgccatggagttgaggcaagtaaagaacattatggttgtgtcgtcgatctcttgtgccgttcagggaagatggtagaagcttatgagtttgtgaagtccattcctttagaagtcactgaatccattattggagctttgctgaacgggtgtaaagtccatggaagaagagatcttgctaaattgatggctcaggatattctgaaaatggagttaaagagacctggaggttttgtaacactctcaaatatctatgctgctgatggagaatgggaagaagttgagtatgtaaggaaggtgatgaagcagaggaaggtccttaagaaacctggatttagttcactcgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

16.91

Weight (kDa)

6.9

Isoelectric Point (pI)

42.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014707)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 48
AflII CTTAAG 1 cut(s) 431
AjnI CCWGG 2 cut(s) 334, 439
AjuI GAANNNNNNNTTGG 2 cut(s) 225, 257
AluBI AGCT 2 cut(s) 194, 248
AluI AGCT 2 cut(s) 194, 248
Alw26I GTCTC 1 cut(s) 325
ApeKI GCWGC 2 cut(s) 60, 368
AspS9I GGNCC 2 cut(s) 102, 427
AsuHPI GGTGA 1 cut(s) 421
AvaII GGWCC 2 cut(s) 102, 427
BbvI GCAGC 2 cut(s) 72, 355
BccI CCATC 3 cut(s) 178, 292, 368
BceAI ACGGC 1 cut(s) 156
BciT130I CCWGG 2 cut(s) 336, 441
BcoDI GTCTC 1 cut(s) 325
BfmI CTRYAG 1 cut(s) 75
BfrI CTTAAG 1 cut(s) 431
BglII AGATCT 1 cut(s) 283
BisI GCNGC 2 cut(s) 61, 369
BlsI GCNGC 2 cut(s) 62, 370
Bme1390I CCNGG 2 cut(s) 336, 441
Bme18I GGWCC 2 cut(s) 102, 427
BmgT120I GGNCC 2 cut(s) 102, 427
BmrFI CCNGG 2 cut(s) 336, 441
BpmI CTGGAG 1 cut(s) 357
Bpu10I CCTNAGC 1 cut(s) 303
BsaI GGTCTC 1 cut(s) 325
BsaJI CCNNGG 2 cut(s) 118, 271
BsaXI ACNNNNNCTCC 2 cut(s) 330, 360
BseBI CCWGG 2 cut(s) 336, 441
BseDI CCNNGG 2 cut(s) 118, 271
BseMII CTCAG 1 cut(s) 317
BseRI GAGGAG 1 cut(s) 27
BseXI GCAGC 2 cut(s) 72, 355
BsmAI GTCTC 1 cut(s) 325
Bso31I GGTCTC 1 cut(s) 325
Bsp143I GATC 2 cut(s) 160, 283
Bsp19I CCATGG 2 cut(s) 118, 271
BspCNI CTCAG 1 cut(s) 316
BspTI CTTAAG 1 cut(s) 431
BspTNI GGTCTC 1 cut(s) 325
BssECI CCNNGG 2 cut(s) 118, 271
BssMI GATC 2 cut(s) 160, 283
BssT1I CCWWGG 2 cut(s) 118, 271
Bst2UI CCWGG 2 cut(s) 336, 441
Bst6I CTCTTC 1 cut(s) 274
BstAFI CTTAAG 1 cut(s) 431
BstC8I GCNNGC 1 cut(s) 58
BstDEI CTNAG 1 cut(s) 303
BstDSI CCRYGG 2 cut(s) 118, 271
BstKTI GATC 2 cut(s) 163, 286
BstMAI GTCTC 1 cut(s) 325
BstMBI GATC 2 cut(s) 160, 283
BstNI CCWGG 2 cut(s) 336, 441
BstNSI RCATGY 1 cut(s) 60
BstSCI CCNGG 2 cut(s) 334, 439
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 2 cut(s) 72, 355
BstX2I RGATCY 1 cut(s) 283
BstYI RGATCY 1 cut(s) 283
BtgI CCRYGG 2 cut(s) 118, 271
BtsIMutI CAGTG 1 cut(s) 228
Cac8I GCNNGC 1 cut(s) 58
Cfr13I GGNCC 2 cut(s) 102, 427
Csp6I GTAC 1 cut(s) 47
CviAII CATG 4 cut(s) 57, 106, 119, 272
CviJI RGCY 5 cut(s) 23, 63, 194, 248, 302
CviKI_1 RGCY 5 cut(s) 23, 63, 194, 248, 302
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 1 cut(s) 303
DpnI GATC 2 cut(s) 162, 285
DpnII GATC 2 cut(s) 160, 283
Eam1104I CTCTTC 1 cut(s) 274
EarI CTCTTC 1 cut(s) 274
Eco130I CCWWGG 2 cut(s) 118, 271
Eco31I GGTCTC 1 cut(s) 325
Eco47I GGWCC 2 cut(s) 102, 427
EcoO109I RGGNCCY 1 cut(s) 427
EcoRII CCWGG 2 cut(s) 334, 439
EcoT14I CCWWGG 2 cut(s) 118, 271
ErhI CCWWGG 2 cut(s) 118, 271
FaeI CATG 4 cut(s) 60, 109, 122, 275
FaiI YATR 9 cut(s) 58, 66, 107, 120, 147, 198, 273, 366, 399
FatI CATG 4 cut(s) 56, 105, 118, 271
Fnu4HI GCNGC 2 cut(s) 61, 369
Fsp4HI GCNGC 2 cut(s) 61, 369
GluI GCNGC 2 cut(s) 61, 369
GsuI CTGGAG 1 cut(s) 357
Hin1II CATG 4 cut(s) 60, 109, 122, 275
HindIII AAGCTT 1 cut(s) 192
HinfI GANTC 1 cut(s) 233
HphI GGTGA 1 cut(s) 421
Hpy166II GTNNAC 2 cut(s) 47, 452
Hpy188I TCNGA 1 cut(s) 315
Hpy188III TCNNGA 1 cut(s) 305
Hpy8I GTNNAC 2 cut(s) 47, 452
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 2 cut(s) 400, 418
HpyCH4V TGCA 3 cut(s) 4, 56, 60
HpyF3I CTNAG 1 cut(s) 303
Hsp92II CATG 4 cut(s) 60, 109, 122, 275
Kzo9I GATC 2 cut(s) 160, 283
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 8 cut(s) 5, 85, 162, 290, 321, 348, 426, 453
Lsp1109I GCAGC 2 cut(s) 72, 355
MaeIII GTNAC 3 cut(s) 31, 226, 346
MalI GATC 2 cut(s) 162, 285
MboI GATC 2 cut(s) 160, 283
MboII GAAGA 4 cut(s) 193, 288, 291, 398
MflI RGATCY 1 cut(s) 283
MluCI AATT 1 cut(s) 293
MnlI CCTC 4 cut(s) 5, 121, 332, 414
MseI TTAA 3 cut(s) 326, 432, 460
MspCI CTTAAG 1 cut(s) 431
MspR9I CCNGG 2 cut(s) 336, 441
MvaI CCWGG 2 cut(s) 336, 441
NcoI CCATGG 2 cut(s) 118, 271
NdeII GATC 2 cut(s) 160, 283
NlaIII CATG 4 cut(s) 60, 109, 122, 275
NmuCI GTSAC 2 cut(s) 31, 226
NspI RCATGY 1 cut(s) 60
PaeI GCATGC 1 cut(s) 60
PfeI GAWTC 1 cut(s) 233
PkrI GCNGC 2 cut(s) 62, 370
PpuMI RGGWCCY 1 cut(s) 427
Psp5II RGGWCCY 1 cut(s) 427
Psp6I CCWGG 2 cut(s) 334, 439
PspGI CCWGG 2 cut(s) 334, 439
PspPI GGNCC 2 cut(s) 102, 427
PspPPI RGGWCCY 1 cut(s) 427
PsuI RGATCY 1 cut(s) 283
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 3 cut(s) 326, 432, 460
SatI GCNGC 2 cut(s) 61, 369
Sau3AI GATC 2 cut(s) 160, 283
Sau96I GGNCC 2 cut(s) 102, 427
ScrFI CCNGG 2 cut(s) 336, 441
SetI ASST 8 cut(s) 104, 196, 250, 337, 343, 411, 429, 442
SfcI CTRYAG 1 cut(s) 75
SinI GGWCC 2 cut(s) 102, 427
SmlI CTYRAG 1 cut(s) 431
SmoI CTYRAG 1 cut(s) 431
SphI GCATGC 1 cut(s) 60
Sse9I AATT 1 cut(s) 293
StyD4I CCNGG 2 cut(s) 334, 439
StyI CCWWGG 2 cut(s) 118, 271
TaqI TCGA 2 cut(s) 159, 456
TasI AATT 1 cut(s) 293
TatI WGTACW 1 cut(s) 46
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 3 cut(s) 326, 432, 460
Tru9I TTAA 3 cut(s) 326, 432, 460
TscAI CASTG 1 cut(s) 235
TseFI GTSAC 2 cut(s) 31, 226
TseI GCWGC 2 cut(s) 60, 368
Tsp45I GTSAC 2 cut(s) 31, 226
TspDTI ATGAA 3 cut(s) 42, 122, 428
TspRI CASTG 1 cut(s) 235
Vha464I CTTAAG 1 cut(s) 431
VpaK11BI GGWCC 2 cut(s) 102, 427
XceI RCATGY 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.