Rmu_sc0031428.1_g000002

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031428.1
Physical Location & Seq
Forward (+)
2090 .. 3682
1593 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031428.1_g000002.1.cds

Sequence Viewer

Length: 1593 bp
atgaaaacaccatctttctcattgttcaagttctccccagaccatttcgctctttgcttgcaaaactgcctgaaagcaaagactctgagacaagggaagcaagtccatgcagtgttgttatcatctggggttgacatgaacttgttatctttgagttcaaagcttgtgggtatgtatgcaagttgtggggacgtgagttctgcacggaaggtgttcgataaaattcccaaaccaaatgtgttttcattgaattggatggtgtttgcttcggcgtttaatgggtggtttgagcaagcaattgggtacttttgtttgatgcgagagttgggaattgttgccaataagttcagttttccggtcatgcttaaagtgtgtgttggtttgatggatttgaataagggaaaggaagttcatgctgtggtgtataagatggggtttgaaaaggatgttgctttggggaatgcattggttgatatgtattgcaaatgtggaagcttgtgttatggtcatcgagtttttgatcgaatgtttgaaagagatgtggcttcttggacatctatgatatgtgggtattgtaatgtaggaaggactgatcaagcggcaatgttgtttgagaggatgaagttggatggattggaaccaaatgatttcacatggaatgcaatgatagctgggtatgctcggagtggagatggcaatcgagcatatgtgctattatctaggatgactaaagaaggattggttcctgatttggttacatggaatgcaataatttcaggttttgcccaaagccaggaggcaggtgaagcttttaagttgttcagtgctatgttagtgtctggaattaagcccaaccttgtcactatcacaggattgctcccagcttgtggagtgcttggttcagttgaaagagggagagaaattcatggattgatatataggatgggttttgacataaatgtctttgttgctagtgctcttattgacatgtactcgaaatgtggcagtgtgaaaaatgctcgaagtgtatttgactggactcctgtatacaatgttgcgtcgtggaatgcaatgattggatgttatggtaagcacggtatggctgattctgcggtagagcttttcgaaagaatgcaagagggaggagttcaggctaatgaagtgactttgagttgtgtactttctgcatgcagccatagtggttctgtagaaaagggtttagagatattcaggtccatgaaagagtgccatggagttgaggcaagtaaagaacattatggttgtgtcgtcgatctcttgtgccgttcagggaagatggtagaagcttatgagtttgtgaagtccattcctttagaagtcactgaatccattattggagctttgctgaacgggtgtaaagtccatggaagaagagatcttgctaaattgatggctcaggatattctgaaaatggagttaaagagacctggaggttttgtaacactctcaaatatctatgctgctgatggagaatgggaagaagttgagtatgtaaggaaggtgatgaagcagaggaaggtccttaagaaacctggatttagttcactcgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

530

Amino Acids

58.55

Weight (kDa)

8.49

Isoelectric Point (pI)

29.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014707)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 791
AasI GACNNNNNNGTC 1 cut(s) 959
Acc36I ACCTGC 1 cut(s) 791
AccB7I CCANNNNNTGG 1 cut(s) 887
AccI GTMKAC 1 cut(s) 1047
AciI CCGC 2 cut(s) 599, 1112
AcsI RAATTY 2 cut(s) 222, 921
AfaI GTAC 3 cut(s) 305, 992, 1179
AfiI CCNNNNNNNGG 2 cut(s) 793, 887
AflII CTTAAG 1 cut(s) 1562
AflIII ACRYGT 1 cut(s) 987
AgsI TTSAA 7 cut(s) 28, 159, 250, 394, 440, 533, 908
AjiI CACGTC 1 cut(s) 193
AjnI CCWGG 3 cut(s) 792, 1465, 1570
AjuI GAANNNNNNNTTGG 4 cut(s) 226, 258, 1356, 1388
AloI GAACNNNNNNTCC 2 cut(s) 393, 425
AluBI AGCT 8 cut(s) 163, 495, 671, 809, 884, 1120, 1325, 1379
AluI AGCT 8 cut(s) 163, 495, 671, 809, 884, 1120, 1325, 1379
Alw21I GWGCWC 1 cut(s) 979
Alw26I GTCTC 2 cut(s) 82, 1456
ApeKI GCWGC 2 cut(s) 1191, 1499
ApoI RAATTY 2 cut(s) 222, 921
Asp700I GAANNNNTTC 1 cut(s) 212
AspS9I GGNCC 2 cut(s) 1233, 1558
AsuHPI GGTGA 2 cut(s) 815, 1552
AsuII TTCGAA 1 cut(s) 1125
AvaII GGWCC 2 cut(s) 1233, 1558
BaeI ACNNNNGTAYC 2 cut(s) 295, 328
Bbv12I GWGCWC 1 cut(s) 979
BbvI GCAGC 2 cut(s) 1203, 1486
BceAI ACGGC 1 cut(s) 1287
BciT130I CCWGG 3 cut(s) 794, 1467, 1572
BclI TGATCA 1 cut(s) 592
BcoDI GTCTC 2 cut(s) 82, 1456
BfaI CTAG 2 cut(s) 720, 972
BfmI CTRYAG 1 cut(s) 1206
BfrI CTTAAG 1 cut(s) 1562
BfuAI ACCTGC 1 cut(s) 791
BglII AGATCT 1 cut(s) 1414
BisI GCNGC 3 cut(s) 600, 1192, 1500
BlsI GCNGC 3 cut(s) 601, 1193, 1501
Bme1390I CCNGG 3 cut(s) 794, 1467, 1572
Bme18I GGWCC 2 cut(s) 1233, 1558
BmgBI CACGTC 1 cut(s) 193
BmgT120I GGNCC 2 cut(s) 1233, 1558
BmiI GGNNCC 2 cut(s) 639, 744
BmrFI CCNGG 3 cut(s) 794, 1467, 1572
BmsI GCATC 1 cut(s) 306
BpmI CTGGAG 1 cut(s) 1488
Bpu10I CCTNAGC 1 cut(s) 1434
Bpu14I TTCGAA 1 cut(s) 1125
BsaBI GATNNNNATC 1 cut(s) 696
BsaI GGTCTC 1 cut(s) 1456
BsaJI CCNNGG 2 cut(s) 1249, 1402
BsaWI WCCGGW 1 cut(s) 355
BsaXI ACNNNNNCTCC 2 cut(s) 1461, 1491
Bsc4I CCNNNNNNNGG 2 cut(s) 793, 887
Bse1I ACTGG 1 cut(s) 1040
Bse3DI GCAATG 3 cut(s) 609, 669, 1077
Bse8I GATNNNNATC 1 cut(s) 696
BseBI CCWGG 3 cut(s) 794, 1467, 1572
BseDI CCNNGG 2 cut(s) 1249, 1402
BseGI GGATG 7 cut(s) 261, 451, 624, 634, 729, 948, 1085
BseJI GATNNNNATC 1 cut(s) 696
BseLI CCNNNNNNNGG 2 cut(s) 793, 887
BseMI GCAATG 3 cut(s) 609, 669, 1077
BseMII CTCAG 2 cut(s) 77, 1448
BseNI ACTGG 1 cut(s) 1040
BseRI GAGGAG 1 cut(s) 1158
BseXI GCAGC 2 cut(s) 1203, 1486
BseYI CCCAGC 2 cut(s) 671, 880
BsgI GTGCAG 1 cut(s) 186
BsiHKAI GWGCWC 1 cut(s) 979
BsiSI CCGG 1 cut(s) 356
BslFI GGGAC 1 cut(s) 203
BslI CCNNNNNNNGG 2 cut(s) 793, 887
BsmAI GTCTC 2 cut(s) 82, 1456
BsmFI GGGAC 1 cut(s) 203
BsmI GAATGC 5 cut(s) 466, 664, 769, 1072, 1137
Bso31I GGTCTC 1 cut(s) 1456
Bsp119I TTCGAA 1 cut(s) 1125
Bsp1286I GDGCHC 1 cut(s) 979
Bsp143I GATC 4 cut(s) 520, 592, 1291, 1414
Bsp19I CCATGG 2 cut(s) 1249, 1402
BspACI CCGC 2 cut(s) 599, 1112
BspCNI CTCAG 2 cut(s) 78, 1447
BspLI GGNNCC 2 cut(s) 639, 744
BspMI ACCTGC 1 cut(s) 791
BspT104I TTCGAA 1 cut(s) 1125
BspTI CTTAAG 1 cut(s) 1562
BspTNI GGTCTC 1 cut(s) 1456
BsrDI GCAATG 3 cut(s) 609, 669, 1077
BsrI ACTGG 1 cut(s) 1040
BssECI CCNNGG 2 cut(s) 1249, 1402
BssMI GATC 4 cut(s) 520, 592, 1291, 1414
BssNAI GTATAC 1 cut(s) 1048
BssT1I CCWWGG 2 cut(s) 1249, 1402
Bst1107I GTATAC 1 cut(s) 1048
Bst2UI CCWGG 3 cut(s) 794, 1467, 1572
Bst4CI ACNGT 1 cut(s) 1097
Bst6I CTCTTC 1 cut(s) 1405
BstAFI CTTAAG 1 cut(s) 1562
BstBI TTCGAA 1 cut(s) 1125
BstC8I GCNNGC 3 cut(s) 59, 294, 1189
BstDEI CTNAG 2 cut(s) 86, 1434
BstDSI CCRYGG 2 cut(s) 1249, 1402
BstF5I GGATG 7 cut(s) 261, 451, 624, 634, 729, 948, 1085
BstKTI GATC 4 cut(s) 523, 595, 1294, 1417
BstMAI GTCTC 2 cut(s) 82, 1456
BstMBI GATC 4 cut(s) 520, 592, 1291, 1414
BstMWI GCNNNNNNNGC 4 cut(s) 668, 677, 806, 1109
BstNI CCWGG 3 cut(s) 794, 1467, 1572
BstNSI RCATGY 2 cut(s) 991, 1191
BstSCI CCNGG 3 cut(s) 792, 1465, 1570
BstSFI CTRYAG 1 cut(s) 1206
BstV1I GCAGC 2 cut(s) 1203, 1486
BstX2I RGATCY 1 cut(s) 1414
BstYI RGATCY 1 cut(s) 1414
BstZ17I GTATAC 1 cut(s) 1048
BtgI CCRYGG 2 cut(s) 1249, 1402
BtrI CACGTC 1 cut(s) 193
BtsCI GGATG 7 cut(s) 261, 451, 624, 634, 729, 948, 1085
BtsI GCAGTG 2 cut(s) 117, 1012
BtsIMutI CAGTG 4 cut(s) 117, 829, 1012, 1359
BveI ACCTGC 1 cut(s) 791
Cac8I GCNNGC 3 cut(s) 59, 294, 1189
Cfr13I GGNCC 2 cut(s) 1233, 1558
CseI GACGC 1 cut(s) 1047
Csp6I GTAC 3 cut(s) 304, 991, 1178
CspCI CAANNNNNGTGG 2 cut(s) 147, 182
CviQI GTAC 3 cut(s) 304, 991, 1178
DdeI CTNAG 2 cut(s) 86, 1434
DpnI GATC 4 cut(s) 522, 594, 1293, 1416
DpnII GATC 4 cut(s) 520, 592, 1291, 1414
DrdI GACNNNNNNGTC 1 cut(s) 959
DseDI GACNNNNNNGTC 1 cut(s) 959
Eam1104I CTCTTC 1 cut(s) 1405
EarI CTCTTC 1 cut(s) 1405
Eco130I CCWWGG 2 cut(s) 1249, 1402
Eco31I GGTCTC 1 cut(s) 1456
Eco47I GGWCC 2 cut(s) 1233, 1558
EcoO109I RGGNCCY 1 cut(s) 1558
EcoRII CCWGG 3 cut(s) 792, 1465, 1570
EcoT14I CCWWGG 2 cut(s) 1249, 1402
EcoT22I ATGCAT 1 cut(s) 466
ErhI CCWWGG 2 cut(s) 1249, 1402
FaqI GGGAC 1 cut(s) 203
FauNDI CATATG 1 cut(s) 706
FbaI TGATCA 1 cut(s) 592
FblI GTMKAC 1 cut(s) 1047
Fnu4HI GCNGC 3 cut(s) 600, 1192, 1500
FokI GGATG 7 cut(s) 268, 458, 631, 641, 736, 955, 1092
Fsp4HI GCNGC 3 cut(s) 600, 1192, 1500
FspBI CTAG 2 cut(s) 720, 972
GluI GCNGC 3 cut(s) 600, 1192, 1500
GsaI CCCAGC 2 cut(s) 675, 884
GsuI CTGGAG 1 cut(s) 1488
HapII CCGG 1 cut(s) 356
HgaI GACGC 1 cut(s) 1047
HincII GTYRAC 1 cut(s) 133
HindII GTYRAC 1 cut(s) 133
HindIII AAGCTT 4 cut(s) 161, 493, 807, 1323
HinfI GANTC 4 cut(s) 82, 1039, 1106, 1364
HpaII CCGG 1 cut(s) 356
HphI GGTGA 2 cut(s) 815, 1552
Hpy166II GTNNAC 4 cut(s) 133, 1048, 1178, 1583
Hpy188I TCNGA 3 cut(s) 87, 684, 1446
Hpy188III TCNNGA 3 cut(s) 746, 840, 1436
Hpy8I GTNNAC 4 cut(s) 133, 1048, 1178, 1583
Hpy99I CGWCG 2 cut(s) 1063, 1292
HpyAV CCTTC 5 cut(s) 202, 579, 728, 1531, 1549
HpyCH4III ACNGT 1 cut(s) 1097
HpyCH4IV ACGT 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 4 cut(s) 668, 677, 806, 1109
HpyF3I CTNAG 2 cut(s) 86, 1434
HpySE526I ACGT 1 cut(s) 192
Ksp22I TGATCA 1 cut(s) 592
Kzo9I GATC 4 cut(s) 520, 592, 1291, 1414
LmnI GCTCC 2 cut(s) 882, 1376
Lsp1109I GCAGC 2 cut(s) 1203, 1486
LweI GCATC 1 cut(s) 306
MaeI CTAG 2 cut(s) 720, 972
MaeII ACGT 1 cut(s) 192
MaeIII GTNAC 5 cut(s) 754, 859, 1162, 1357, 1477
MalI GATC 4 cut(s) 522, 594, 1293, 1416
MboI GATC 4 cut(s) 520, 592, 1291, 1414
MboII GAAGA 4 cut(s) 1324, 1419, 1422, 1529
MfeI CAATTG 1 cut(s) 297
MflI RGATCY 1 cut(s) 1414
MhlI GDGCHC 1 cut(s) 979
MluCI AATT 8 cut(s) 222, 250, 297, 330, 771, 843, 921, 1424
MlyI GAGTC 2 cut(s) 76, 1033
MmeI TCCRAC 1 cut(s) 606
MnlI CCTC 8 cut(s) 609, 790, 905, 1132, 1136, 1252, 1463, 1545
Mph1103I ATGCAT 1 cut(s) 466
MroXI GAANNNNTTC 1 cut(s) 212
MseI TTAA 7 cut(s) 276, 366, 813, 846, 1457, 1563, 1591
MspCI CTTAAG 1 cut(s) 1562
MspI CCGG 1 cut(s) 356
MspR9I CCNGG 3 cut(s) 794, 1467, 1572
MunI CAATTG 1 cut(s) 297
Mva1269I GAATGC 5 cut(s) 466, 664, 769, 1072, 1137
MvaI CCWGG 3 cut(s) 794, 1467, 1572
MwoI GCNNNNNNNGC 4 cut(s) 668, 677, 806, 1109
NcoI CCATGG 2 cut(s) 1249, 1402
NdeI CATATG 1 cut(s) 706
NdeII GATC 4 cut(s) 520, 592, 1291, 1414
NlaIV GGNNCC 2 cut(s) 639, 744
NmuCI GTSAC 3 cut(s) 859, 1162, 1357
NsiI ATGCAT 1 cut(s) 466
NspI RCATGY 2 cut(s) 991, 1191
NspV TTCGAA 1 cut(s) 1125
PaeI GCATGC 1 cut(s) 1191
PaqCI CACCTGC 1 cut(s) 791
PciI ACATGT 1 cut(s) 987
PctI GAATGC 5 cut(s) 466, 664, 769, 1072, 1137
PdmI GAANNNNTTC 1 cut(s) 212
PfeI GAWTC 2 cut(s) 1106, 1364
PflMI CCANNNNNTGG 1 cut(s) 887
PkrI GCNGC 3 cut(s) 601, 1193, 1501
PleI GAGTC 2 cut(s) 76, 1033
PpsI GAGTC 2 cut(s) 76, 1033
PpuMI RGGWCCY 1 cut(s) 1558
PscI ACATGT 1 cut(s) 987
Psp5II RGGWCCY 1 cut(s) 1558
Psp6I CCWGG 3 cut(s) 792, 1465, 1570
PspFI CCCAGC 2 cut(s) 671, 880
PspGI CCWGG 3 cut(s) 792, 1465, 1570
PspN4I GGNNCC 2 cut(s) 639, 744
PspPI GGNCC 2 cut(s) 1233, 1558
PspPPI RGGWCCY 1 cut(s) 1558
PsuI RGATCY 1 cut(s) 1414
RsaI GTAC 3 cut(s) 305, 992, 1179
RsaNI GTAC 3 cut(s) 304, 991, 1178
SaqAI TTAA 7 cut(s) 276, 366, 813, 846, 1457, 1563, 1591
SatI GCNGC 3 cut(s) 600, 1192, 1500
Sau3AI GATC 4 cut(s) 520, 592, 1291, 1414
Sau96I GGNCC 2 cut(s) 1233, 1558
SchI GAGTC 2 cut(s) 76, 1033
ScrFI CCNGG 3 cut(s) 794, 1467, 1572
SduI GDGCHC 1 cut(s) 979
SfaNI GCATC 1 cut(s) 306
SfcI CTRYAG 1 cut(s) 1206
SfuI TTCGAA 1 cut(s) 1125
SinI GGWCC 2 cut(s) 1233, 1558
SmlI CTYRAG 1 cut(s) 1562
SmoI CTYRAG 1 cut(s) 1562
SphI GCATGC 1 cut(s) 1191
Sse9I AATT 8 cut(s) 222, 250, 297, 330, 771, 843, 921, 1424
SsiI CCGC 2 cut(s) 599, 1112
SspMI CTAG 2 cut(s) 720, 972
StyD4I CCNGG 3 cut(s) 792, 1465, 1570
StyI CCWWGG 2 cut(s) 1249, 1402
TaaI ACNGT 1 cut(s) 1097
TaiI ACGT 1 cut(s) 195
TaqI TCGA 9 cut(s) 216, 511, 523, 700, 995, 1021, 1125, 1290, 1587
TasI AATT 8 cut(s) 222, 250, 297, 330, 771, 843, 921, 1424
TatI WGTACW 2 cut(s) 990, 1177
TauI GCSGC 1 cut(s) 602
TfiI GAWTC 2 cut(s) 1106, 1364
Tru1I TTAA 7 cut(s) 276, 366, 813, 846, 1457, 1563, 1591
Tru9I TTAA 7 cut(s) 276, 366, 813, 846, 1457, 1563, 1591
TscAI CASTG 4 cut(s) 117, 829, 1012, 1366
TseFI GTSAC 3 cut(s) 859, 1162, 1357
TseI GCWGC 2 cut(s) 1191, 1499
Tsp45I GTSAC 3 cut(s) 859, 1162, 1357
TspDTI ATGAA 9 cut(s) 17, 152, 234, 401, 635, 914, 1173, 1253, 1559
TspGWI ACGGA 1 cut(s) 220
TspRI CASTG 4 cut(s) 117, 829, 1012, 1366
Van91I CCANNNNNTGG 1 cut(s) 887
Vha464I CTTAAG 1 cut(s) 1562
VpaK11BI GGWCC 2 cut(s) 1233, 1558
XapI RAATTY 2 cut(s) 222, 921
XceI RCATGY 2 cut(s) 991, 1191
XmiI GTMKAC 1 cut(s) 1047
XmnI GAANNNNTTC 1 cut(s) 212
XspI CTAG 2 cut(s) 720, 972
Zsp2I ATGCAT 1 cut(s) 466
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.