Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8111106.1

Orthogroup ID

OG0020379

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 432

Gene Structure 432 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8111106.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 310 bp

ggtgccatgccggaagcgaggagggatcaggttcaagatcaatggcaacccccacttcaacttggttctgatcaccaacgtcgccggtgctggagacgttgtgggggtgagcatcaaagggtccaaaactggatggatgccaatgacccgtaactgggggcagaactggcagtcaggcaccgtcttggtcggacagtcgctctccttcagtgtcaaaaccagtgacggtcgctacactacttcttggaacgttgtcccttccaattggcagtttggtcaatctttctccggaaaaaacttcagagtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005911 GO:0006949 GO:0008150 GO:0009505 GO:0009506 GO:0009653 GO:0009987 GO:0030054 GO:0030312 GO:0032502 GO:0044424 GO:0044444 GO:0044464 GO:0048646 GO:0048856 GO:0055044 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DPBB_1 Pollen_allerg_1

Protein Analysis

102

Amino Acids

11.19

Weight (kDa)

11.42

Isoelectric Point (pI)

17.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020379)

Species	Orthologous Gene IDs
malus_domestica	MD02G1138400.v1.1
pyrus_communis	pycom02g10970
rosa_chinensis	RchiOBHm_Chr5g0061561
rosa_multiflora	Rmu_co8111106.1_g000001 Rmu_co8391917.1_g000001 Rmu_sc0038331.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	2, 177
AccIII	TCCGGA	1 cut(s)	288
AclI	AACGTT	1 cut(s)	250
AclWI	GGATC	1 cut(s)	33
AcuI	CTGAAG	2 cut(s)	191, 284
AfiI	CCNNNNNNNGG	2 cut(s)	154, 155
AgsI	TTSAA	2 cut(s)	35, 59
Alw26I	GTCTC	1 cut(s)	88
AlwI	GGATC	1 cut(s)	33
AlwNI	CAGNNNCTG	1 cut(s)	307
Aor13HI	TCCGGA	1 cut(s)	288
AspS9I	GGNCC	1 cut(s)	121
AsuHPI	GGTGA	2 cut(s)	65, 119
AvaII	GGWCC	1 cut(s)	121
BanI	GGYRCC	2 cut(s)	2, 177
BccI	CCATC	1 cut(s)	127
BclI	TGATCA	1 cut(s)	70
BcoDI	GTCTC	1 cut(s)	88
Bme18I	GGWCC	1 cut(s)	121
BmgT120I	GGNCC	1 cut(s)	121
BmiI	GGNNCC	3 cut(s)	4, 122, 179
BmrI	ACTGGG	1 cut(s)	164
BmsI	GCATC	2 cut(s)	121, 127
BmuI	ACTGGG	1 cut(s)	164
BpmI	CTGGAG	1 cut(s)	112
BsaWI	WCCGGW	1 cut(s)	288
BsaXI	ACNNNNNCTCC	2 cut(s)	85, 115
Bsc4I	CCNNNNNNNGG	2 cut(s)	154, 155
Bse118I	RCCGGY	1 cut(s)	84
Bse1I	ACTGG	4 cut(s)	134, 159, 171, 220
BseAI	TCCGGA	1 cut(s)	288
BseGI	GGATG	2 cut(s)	138, 142
BseLI	CCNNNNNNNGG	2 cut(s)	154, 155
BseNI	ACTGG	4 cut(s)	134, 159, 171, 220
BseRI	GAGGAG	1 cut(s)	34
Bsh1285I	CGRYCG	1 cut(s)	230
BshNI	GGYRCC	2 cut(s)	2, 177
BsiEI	CGRYCG	1 cut(s)	230
BsiSI	CCGG	3 cut(s)	11, 85, 289
BslFI	GGGAC	1 cut(s)	240
BslI	CCNNNNNNNGG	2 cut(s)	154, 155
BsmAI	GTCTC	1 cut(s)	88
BsmBI	CGTCTC	1 cut(s)	88
BsmFI	GGGAC	1 cut(s)	240
Bsp13I	TCCGGA	1 cut(s)	288
Bsp143I	GATC	3 cut(s)	25, 37, 70
BspEI	TCCGGA	1 cut(s)	288
BspLI	GGNNCC	3 cut(s)	4, 122, 179
BspPI	GGATC	1 cut(s)	33
BspT107I	GGYRCC	2 cut(s)	2, 177
BsrFI	RCCGGY	1 cut(s)	84
BsrI	ACTGG	4 cut(s)	134, 159, 171, 220
BssAI	RCCGGY	1 cut(s)	84
BssMI	GATC	3 cut(s)	25, 37, 70
Bst4CI	ACNGT	3 cut(s)	182, 196, 228
BstF5I	GGATG	2 cut(s)	138, 142
BstKTI	GATC	3 cut(s)	28, 40, 73
BstMAI	GTCTC	1 cut(s)	88
BstMBI	GATC	3 cut(s)	25, 37, 70
BstMCI	CGRYCG	1 cut(s)	230
BstMWI	GCNNNNNNNGC	1 cut(s)	167
BtsCI	GGATG	2 cut(s)	138, 142
BtsIMutI	CAGTG	2 cut(s)	215, 227
CaiI	CAGNNNCTG	1 cut(s)	307
Cfr10I	RCCGGY	1 cut(s)	84
Cfr13I	GGNCC	1 cut(s)	121
CviAII	CATG	1 cut(s)	7
DpnI	GATC	3 cut(s)	27, 39, 72
DpnII	GATC	3 cut(s)	25, 37, 70
Eco47I	GGWCC	1 cut(s)	121
Eco57I	CTGAAG	2 cut(s)	191, 284
Esp3I	CGTCTC	1 cut(s)	88
FaeI	CATG	1 cut(s)	10
FaiI	YATR	1 cut(s)	8
FaqI	GGGAC	1 cut(s)	240
FatI	CATG	1 cut(s)	6
FbaI	TGATCA	1 cut(s)	70
FokI	GGATG	2 cut(s)	145, 149
GsuI	CTGGAG	1 cut(s)	112
HapII	CCGG	3 cut(s)	11, 85, 289
Hin1II	CATG	1 cut(s)	10
HinfI	GANTC	1 cut(s)	304
HpaII	CCGG	3 cut(s)	11, 85, 289
HphI	GGTGA	2 cut(s)	65, 119
Hpy188I	TCNGA	4 cut(s)	70, 192, 303, 309
Hpy188III	TCNNGA	2 cut(s)	35, 289
Hpy99I	CGWCG	1 cut(s)	84
HpyAV	CCTTC	2 cut(s)	215, 268
HpyCH4III	ACNGT	3 cut(s)	182, 196, 228
HpyCH4IV	ACGT	3 cut(s)	79, 97, 250
HpyF10VI	GCNNNNNNNGC	1 cut(s)	167
HpySE526I	ACGT	3 cut(s)	79, 97, 250
Hsp92II	CATG	1 cut(s)	10
Kpn2I	TCCGGA	1 cut(s)	288
Ksp22I	TGATCA	1 cut(s)	70
Kzo9I	GATC	3 cut(s)	25, 37, 70
LweI	GCATC	2 cut(s)	121, 127
MaeII	ACGT	3 cut(s)	79, 97, 250
MaeIII	GTNAC	2 cut(s)	150, 222
MalI	GATC	3 cut(s)	27, 39, 72
MboI	GATC	3 cut(s)	25, 37, 70
MfeI	CAATTG	1 cut(s)	263
MluCI	AATT	1 cut(s)	263
MmeI	TCCRAC	1 cut(s)	170
MnlI	CCTC	2 cut(s)	12, 15
MroI	TCCGGA	1 cut(s)	288
MspI	CCGG	3 cut(s)	11, 85, 289
MunI	CAATTG	1 cut(s)	263
MwoI	GCNNNNNNNGC	1 cut(s)	167
NdeII	GATC	3 cut(s)	25, 37, 70
NlaIII	CATG	1 cut(s)	10
NlaIV	GGNNCC	3 cut(s)	4, 122, 179
NmuCI	GTSAC	1 cut(s)	222
Psp1406I	AACGTT	1 cut(s)	250
PspN4I	GGNNCC	3 cut(s)	4, 122, 179
PspPI	GGNCC	1 cut(s)	121
PstNI	CAGNNNCTG	1 cut(s)	307
Sau3AI	GATC	3 cut(s)	25, 37, 70
Sau96I	GGNCC	1 cut(s)	121
SetI	ASST	4 cut(s)	33, 82, 100, 253
SfaNI	GCATC	2 cut(s)	121, 127
SgrAI	CRCCGGYG	1 cut(s)	84
SinI	GGWCC	1 cut(s)	121
Sse9I	AATT	1 cut(s)	263
TaaI	ACNGT	3 cut(s)	182, 196, 228
TaiI	ACGT	3 cut(s)	82, 100, 253
TasI	AATT	1 cut(s)	263
TscAI	CASTG	2 cut(s)	215, 227
TseFI	GTSAC	1 cut(s)	222
Tsp45I	GTSAC	1 cut(s)	222
TspRI	CASTG	2 cut(s)	215, 227
VpaK11BI	GGWCC	1 cut(s)	121

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.