Rmu_co8212208.1_g000001

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8212208.1
Physical Location & Seq
Reverse (-)
3 .. 713
711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8212208.1_g000001.1.cds

Sequence Viewer

Length: 387 bp
atgaggtttctttgtggtggcagcaaaaagttatccactcttgcgatatctttattttctgtagcgggagcaatcttcgtagctatcttcatatttctagtatggaggttcagagcaaaactcaaagtgttgcccaccacttcaatttcatggttgagaatcagtgaaacaccaacacacaatgctggcaagagcaaagaattctcaacagaaatgtcaggatcaattgaccctactgtagattggaatcaagtaaatggacctgatgatttgccagcattcagttttaacagtgtagcagctgctacagaccacttttctctagtaaacaagcttgggaatgggggatttggtactgtctacaaggtgaattcatattgcaattga

Protein Analysis

128

Amino Acids

13.93

Weight (kDa)

9.3

Isoelectric Point (pI)

16.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020724)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 360
AciI CCGC 1 cut(s) 65
AclWI GGATC 1 cut(s) 229
AcsI RAATTY 2 cut(s) 200, 370
AfaI GTAC 1 cut(s) 355
AgsI TTSAA 1 cut(s) 144
AluBI AGCT 3 cut(s) 83, 302, 334
AluI AGCT 3 cut(s) 83, 302, 334
AlwI GGATC 1 cut(s) 229
ApeKI GCWGC 3 cut(s) 21, 299, 302
ApoI RAATTY 2 cut(s) 200, 370
AspS9I GGNCC 1 cut(s) 260
AsuHPI GGTGA 1 cut(s) 379
AvaII GGWCC 1 cut(s) 260
BbvI GCAGC 3 cut(s) 33, 289, 311
BfaI CTAG 2 cut(s) 98, 323
BfmI CTRYAG 3 cut(s) 60, 237, 306
BisI GCNGC 3 cut(s) 22, 300, 303
BlsI GCNGC 3 cut(s) 23, 301, 304
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BplI GAGNNNNNCTC 2 cut(s) 105, 137
BsaBI GATNNNNATC 1 cut(s) 246
Bse8I GATNNNNATC 1 cut(s) 246
BseJI GATNNNNATC 1 cut(s) 246
BseXI GCAGC 3 cut(s) 33, 289, 311
BsmI GAATGC 1 cut(s) 278
Bsp143I GATC 1 cut(s) 221
BspACI CCGC 1 cut(s) 65
BspPI GGATC 1 cut(s) 229
BssMI GATC 1 cut(s) 221
Bst4CI ACNGT 3 cut(s) 238, 293, 358
BstC8I GCNNGC 2 cut(s) 187, 276
BstKTI GATC 1 cut(s) 224
BstMBI GATC 1 cut(s) 221
BstSFI CTRYAG 3 cut(s) 60, 237, 306
BstV1I GCAGC 3 cut(s) 33, 289, 311
BtsIMutI CAGTG 2 cut(s) 169, 298
Cac8I GCNNGC 2 cut(s) 187, 276
Cfr13I GGNCC 1 cut(s) 260
Csp6I GTAC 1 cut(s) 354
CviAII CATG 1 cut(s) 150
CviJI RGCY 3 cut(s) 83, 302, 334
CviKI_1 RGCY 3 cut(s) 83, 302, 334
CviQI GTAC 1 cut(s) 354
DpnI GATC 1 cut(s) 223
DpnII GATC 1 cut(s) 221
Eco32I GATATC 1 cut(s) 48
Eco47I GGWCC 1 cut(s) 260
EcoRI GAATTC 2 cut(s) 200, 370
EcoRV GATATC 1 cut(s) 48
FaeI CATG 1 cut(s) 153
FaiI YATR 4 cut(s) 92, 103, 151, 376
FatI CATG 1 cut(s) 149
FauI CCCGC 1 cut(s) 58
FblI GTMKAC 1 cut(s) 360
Fnu4HI GCNGC 3 cut(s) 22, 300, 303
Fsp4HI GCNGC 3 cut(s) 22, 300, 303
FspBI CTAG 2 cut(s) 98, 323
GluI GCNGC 3 cut(s) 22, 300, 303
Hin1II CATG 1 cut(s) 153
HindIII AAGCTT 1 cut(s) 332
HinfI GANTC 2 cut(s) 159, 247
HphI GGTGA 1 cut(s) 379
Hpy166II GTNNAC 2 cut(s) 328, 361
Hpy188I TCNGA 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 219
Hpy8I GTNNAC 2 cut(s) 328, 361
HpyCH4III ACNGT 3 cut(s) 238, 293, 358
HpyCH4V TGCA 1 cut(s) 381
Hsp92II CATG 1 cut(s) 153
Kzo9I GATC 1 cut(s) 221
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 4 cut(s) 171, 204, 276, 288
Lsp1109I GCAGC 3 cut(s) 33, 289, 311
MaeI CTAG 2 cut(s) 98, 323
MalI GATC 1 cut(s) 223
MboI GATC 1 cut(s) 221
MboII GAAGA 2 cut(s) 67, 79
MfeI CAATTG 2 cut(s) 225, 382
MluCI AATT 5 cut(s) 144, 200, 225, 370, 382
MnlI CCTC 1 cut(s) 99
MseI TTAA 1 cut(s) 288
MspA1I CMGCKG 1 cut(s) 302
MunI CAATTG 2 cut(s) 225, 382
Mva1269I GAATGC 1 cut(s) 278
NdeII GATC 1 cut(s) 221
NlaIII CATG 1 cut(s) 153
PctI GAATGC 1 cut(s) 278
PfeI GAWTC 2 cut(s) 159, 247
PkrI GCNGC 3 cut(s) 23, 301, 304
PspPI GGNCC 1 cut(s) 260
PvuII CAGCTG 1 cut(s) 302
RsaI GTAC 1 cut(s) 355
RsaNI GTAC 1 cut(s) 354
SaqAI TTAA 1 cut(s) 288
SatI GCNGC 3 cut(s) 22, 300, 303
Sau3AI GATC 1 cut(s) 221
Sau96I GGNCC 1 cut(s) 260
SetI ASST 7 cut(s) 8, 85, 110, 265, 304, 336, 369
SfcI CTRYAG 3 cut(s) 60, 237, 306
SinI GGWCC 1 cut(s) 260
Sse9I AATT 5 cut(s) 144, 200, 225, 370, 382
SsiI CCGC 1 cut(s) 65
SspMI CTAG 2 cut(s) 98, 323
TaaI ACNGT 3 cut(s) 238, 293, 358
TasI AATT 5 cut(s) 144, 200, 225, 370, 382
TfiI GAWTC 2 cut(s) 159, 247
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 2 cut(s) 169, 298
TseI GCWGC 3 cut(s) 21, 299, 302
TspDTI ATGAA 3 cut(s) 79, 138, 363
TspRI CASTG 2 cut(s) 169, 298
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 2 cut(s) 200, 370
XmiI GTMKAC 1 cut(s) 360
XspI CTAG 2 cut(s) 98, 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.