Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8273625.1

Orthogroup ID

OG0021317

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 731

Gene Structure 731 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8273625.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 350 bp

atgaagatctcggcatccctccaccatctctgccgagcgaggaatggacggcgattggagatcttggttggggatgttgatcaagaagcagcgcaccccgatccggctcctagtgacgtaggagatcgttgctctcatctctaccgtgtggctacaggtccggttcggctcttgacaacccatgccaaagcatacaagcccttcgtcaagagctaccatgtcattgttggggacggtgaagtctgtattcttggtgaggtcccggcctacaacaacatggagaggctagacttgctggatgaggagagcaacctcatcagcttcagcatggtgggtagcgaccgcatgct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04016 ko04075 map04016 map04075

Pfam Domains

Protein Families

Polyketide_cyc2

Protein Analysis

117

Amino Acids

12.96

Weight (kDa)

6.03

Isoelectric Point (pI)

25.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021317)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0360531
rosa_laevigata	RLG00000024364
rosa_multiflora	Rmu_co8273625.1_g000001
rosa_roxburghii	Rroxscaffold_7G00194360
rosa_samantha	Rh1AG291800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	239
AciI	CCGC	1 cut(s)	343
AclWI	GGATC	1 cut(s)	95
AcuI	CTGAAG	1 cut(s)	307
AfiI	CCNNNNNNNGG	1 cut(s)	103
AluBI	AGCT	2 cut(s)	213, 321
AluI	AGCT	2 cut(s)	213, 321
AlwI	GGATC	1 cut(s)	95
AoxI	GGCC	1 cut(s)	264
ApeKI	GCWGC	1 cut(s)	89
AspLEI	GCGC	1 cut(s)	94
AspS9I	GGNCC	2 cut(s)	158, 259
AsuC2I	CCSGG	1 cut(s)	263
AsuHPI	GGTGA	2 cut(s)	248, 266
AvaII	GGWCC	2 cut(s)	158, 259
BbvI	GCAGC	1 cut(s)	101
BccI	CCATC	1 cut(s)	33
BceAI	ACGGC	1 cut(s)	65
BclI	TGATCA	1 cut(s)	79
BcnI	CCSGG	1 cut(s)	263
BfaI	CTAG	2 cut(s)	111, 287
BfmI	CTRYAG	1 cut(s)	153
BglII	AGATCT	2 cut(s)	6, 60
BisI	GCNGC	1 cut(s)	90
BlsI	GCNGC	1 cut(s)	91
Bme1390I	CCNGG	1 cut(s)	263
Bme18I	GGWCC	2 cut(s)	158, 259
BmgT120I	GGNCC	2 cut(s)	158, 259
BmiI	GGNNCC	2 cut(s)	108, 261
BmrFI	CCNGG	1 cut(s)	263
BmsI	GCATC	1 cut(s)	23
BpuMI	CCSGG	1 cut(s)	263
BsaBI	GATNNNNATC	1 cut(s)	78
BsaWI	WCCGGW	1 cut(s)	160
Bsc4I	CCNNNNNNNGG	1 cut(s)	103
Bse8I	GATNNNNATC	1 cut(s)	78
BseGI	GGATG	3 cut(s)	14, 79, 304
BseJI	GATNNNNATC	1 cut(s)	78
BseLI	CCNNNNNNNGG	1 cut(s)	103
BseRI	GAGGAG	1 cut(s)	317
BseXI	GCAGC	1 cut(s)	101
Bsh1285I	CGRYCG	1 cut(s)	343
BshFI	GGCC	1 cut(s)	266
BsiEI	CGRYCG	1 cut(s)	343
BsiSI	CCGG	3 cut(s)	104, 161, 263
BslFI	GGGAC	2 cut(s)	245, 245
BslI	CCNNNNNNNGG	1 cut(s)	103
BsmFI	GGGAC	2 cut(s)	245, 245
BsnI	GGCC	1 cut(s)	266
Bsp143I	GATC	5 cut(s)	6, 60, 79, 100, 124
BspACI	CCGC	1 cut(s)	343
BspANI	GGCC	1 cut(s)	266
BspLI	GGNNCC	2 cut(s)	108, 261
BspPI	GGATC	1 cut(s)	95
BssMI	GATC	5 cut(s)	6, 60, 79, 100, 124
Bst4CI	ACNGT	2 cut(s)	146, 236
BstC8I	GCNNGC	1 cut(s)	347
BstF5I	GGATG	3 cut(s)	14, 79, 304
BstHHI	GCGC	1 cut(s)	94
BstKTI	GATC	5 cut(s)	9, 63, 82, 103, 127
BstMBI	GATC	5 cut(s)	6, 60, 79, 100, 124
BstMCI	CGRYCG	1 cut(s)	343
BstMWI	GCNNNNNNNGC	1 cut(s)	292
BstNSI	RCATGY	1 cut(s)	349
BstSCI	CCNGG	1 cut(s)	261
BstSFI	CTRYAG	1 cut(s)	153
BstV1I	GCAGC	1 cut(s)	101
BstX2I	RGATCY	2 cut(s)	6, 60
BstYI	RGATCY	2 cut(s)	6, 60
BsuRI	GGCC	1 cut(s)	266
BtsCI	GGATG	3 cut(s)	14, 79, 304
Cac8I	GCNNGC	1 cut(s)	347
CfoI	GCGC	1 cut(s)	94
Cfr13I	GGNCC	2 cut(s)	158, 259
CviAII	CATG	5 cut(s)	182, 218, 277, 328, 346
CviJI	RGCY	8 cut(s)	107, 152, 169, 199, 213, 266, 286, 321
CviKI_1	RGCY	8 cut(s)	107, 152, 169, 199, 213, 266, 286, 321
DpnI	GATC	5 cut(s)	8, 62, 81, 102, 126
DpnII	GATC	5 cut(s)	6, 60, 79, 100, 124
DrdI	GACNNNNNNGTC	1 cut(s)	239
DseDI	GACNNNNNNGTC	1 cut(s)	239
Eco47I	GGWCC	2 cut(s)	158, 259
Eco57I	CTGAAG	1 cut(s)	307
EcoO109I	RGGNCCY	1 cut(s)	259
FaeI	CATG	5 cut(s)	185, 221, 280, 331, 349
FaiI	YATR	6 cut(s)	183, 193, 219, 278, 329, 347
FaqI	GGGAC	2 cut(s)	245, 245
FatI	CATG	5 cut(s)	181, 217, 276, 327, 345
FbaI	TGATCA	1 cut(s)	79
Fnu4HI	GCNGC	1 cut(s)	90
FokI	GGATG	2 cut(s)	86, 311
Fsp4HI	GCNGC	1 cut(s)	90
FspBI	CTAG	2 cut(s)	111, 287
GlaI	GCGC	1 cut(s)	93
GluI	GCNGC	1 cut(s)	90
HaeIII	GGCC	1 cut(s)	266
HapII	CCGG	3 cut(s)	104, 161, 263
HhaI	GCGC	1 cut(s)	94
Hin1II	CATG	5 cut(s)	185, 221, 280, 331, 349
Hin6I	GCGC	1 cut(s)	92
HinP1I	GCGC	1 cut(s)	92
HpaII	CCGG	3 cut(s)	104, 161, 263
HphI	GGTGA	2 cut(s)	248, 266
Hpy188III	TCNNGA	3 cut(s)	83, 172, 208
HpyAV	CCTTC	1 cut(s)	211
HpyCH4III	ACNGT	2 cut(s)	146, 236
HpyCH4IV	ACGT	1 cut(s)	117
HpyF10VI	GCNNNNNNNGC	1 cut(s)	292
HpySE526I	ACGT	1 cut(s)	117
Hsp92II	CATG	5 cut(s)	185, 221, 280, 331, 349
HspAI	GCGC	1 cut(s)	92
Ksp22I	TGATCA	1 cut(s)	79
Kzo9I	GATC	5 cut(s)	6, 60, 79, 100, 124
LmnI	GCTCC	1 cut(s)	112
LpnPI	CCDG	5 cut(s)	117, 141, 174, 276, 281
Lsp1109I	GCAGC	1 cut(s)	101
LweI	GCATC	1 cut(s)	23
MaeI	CTAG	2 cut(s)	111, 287
MaeII	ACGT	1 cut(s)	117
MaeIII	GTNAC	1 cut(s)	113
MalI	GATC	5 cut(s)	8, 62, 81, 102, 126
MboI	GATC	5 cut(s)	6, 60, 79, 100, 124
MboII	GAAGA	1 cut(s)	16
MflI	RGATCY	2 cut(s)	6, 60
MnlI	CCTC	6 cut(s)	29, 33, 250, 276, 295, 323
MspI	CCGG	3 cut(s)	104, 161, 263
MspR9I	CCNGG	1 cut(s)	263
MwoI	GCNNNNNNNGC	1 cut(s)	292
NciI	CCSGG	1 cut(s)	263
NdeII	GATC	5 cut(s)	6, 60, 79, 100, 124
NlaIII	CATG	5 cut(s)	185, 221, 280, 331, 349
NlaIV	GGNNCC	2 cut(s)	108, 261
NmeAIII	GCCGAG	1 cut(s)	59
NmuCI	GTSAC	1 cut(s)	113
NspI	RCATGY	1 cut(s)	349
PaeI	GCATGC	1 cut(s)	349
PkrI	GCNGC	1 cut(s)	91
PpuMI	RGGWCCY	1 cut(s)	259
Psp5II	RGGWCCY	1 cut(s)	259
PspN4I	GGNNCC	2 cut(s)	108, 261
PspPI	GGNCC	2 cut(s)	158, 259
PspPPI	RGGWCCY	1 cut(s)	259
PsuI	RGATCY	2 cut(s)	6, 60
SatI	GCNGC	1 cut(s)	90
Sau3AI	GATC	5 cut(s)	6, 60, 79, 100, 124
Sau96I	GGNCC	2 cut(s)	158, 259
ScrFI	CCNGG	1 cut(s)	263
SetI	ASST	6 cut(s)	120, 160, 215, 261, 315, 323
SfaNI	GCATC	1 cut(s)	23
SfcI	CTRYAG	1 cut(s)	153
SinI	GGWCC	2 cut(s)	158, 259
SphI	GCATGC	1 cut(s)	349
SsiI	CCGC	1 cut(s)	343
SspMI	CTAG	2 cut(s)	111, 287
StyD4I	CCNGG	1 cut(s)	261
TaaI	ACNGT	2 cut(s)	146, 236
TaiI	ACGT	1 cut(s)	120
TseFI	GTSAC	1 cut(s)	113
TseI	GCWGC	1 cut(s)	89
Tsp45I	GTSAC	1 cut(s)	113
TspDTI	ATGAA	1 cut(s)	17
VpaK11BI	GGWCC	2 cut(s)	158, 259
XceI	RCATGY	1 cut(s)	349
XcmI	CCANNNNNNNNNTGG	1 cut(s)	224
XspI	CTAG	2 cut(s)	111, 287

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.