Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8297061.1

Orthogroup ID

OG0007153

Physical Location & Seq

Genomic Coordinates Reverse (-)

51 .. 827

Gene Structure 777 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8297061.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 777 bp

atgcaaagatattatttcaggtctacaaatacttttgtagtacgtatttggtcctcgtggcttgtcaagcagacatccgaagcatttgattttgccccagagggtgtggccaagctccaccttgatgctcctgatgaccgcttgatggatgtcattccgcagtttgatgtgattattttctcctctggccattggtttgctaagcagtctgtttatatcctaaacaatgagattgtgggaggacagttgtggtggccagataaatcgaagcaaatgaagattaacaatattgaggcatttggaatatccgttgagacgatgctcactgctcttgctacacatccaaattatacagggattgccattgttcgttcctattcacctgaccattatgaaggcggggcttggaatacaggtggatcatgcactgggaaagtaaggcctcttgcaccagggcagagagtggaaaatggttttacaaatataatgcatgaaaaacaggttatgggttttaaccgtgcaataaagaaattgacaaacaagtcgaagctgaagttgatggatatcaccgaagcttttgagtaccgtcatgatggacatccaggtccatatagaagccctgacccaaataagcaaacaaagcgtggccctgatggaaagccgccaccacaggattgcttacattggtgcatgccaggtccggttgatacttggaacgaatttgtgcttgagatcataaggagagaatatgagggcagcaggaacttatcttcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0007275 GO:0007568 GO:0008150 GO:0008374 GO:0009987 GO:0010150 GO:0012505 GO:0016407 GO:0016413 GO:0016740 GO:0016746 GO:0016747 GO:0032501 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0071554 GO:0090693 GO:0099402

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PC-Esterase PMR5N

Protein Analysis

258

Amino Acids

29.44

Weight (kDa)

8.34

Isoelectric Point (pI)

48.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007153)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G25360 AT4G25360 AT5G51640
fragaria_vesca	FvH4_7g28200 FvH4_7g28200
malus_domestica	MD01G1185900.v1.1 MD07G1258100.v1.1
prunus_persica	Prupe.2G282500_v2.0.a1 Prupe.2G282500_v2.0.a1 Prupe.2G282500_v2.0.a1
pyrus_communis	pycom01g19760 pycom07g23110
rosa_chinensis	RchiOBHm_Chr1g0375151
rosa_laevigata	RLG00000026682
rosa_multiflora	Rmu_co8297061.1_g000001 Rmu_co8308331.1_g000001 Rmu_sc0000554.1_g000023 Rmu_sc0002456.1_g000002
rosa_roxburghii	Rroxscaffold_4G00282970
rosa_rugosa	Rorug01G0388800
rosa_samantha	Rh1AG399400 Rh1BG365100 Rh1CG378000 Rh1DG395800
rosa_wichuraiana	Rw1G035460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	541, 603
AccI	GTMKAC	1 cut(s)	23
AciI	CCGC	4 cut(s)	139, 158, 399, 662
AclWI	GGATC	1 cut(s)	427
AcoI	YGGCCR	3 cut(s)	108, 187, 254
AcsI	RAATTY	1 cut(s)	719
AcuI	CTGAAG	1 cut(s)	572
AfaI	GTAC	2 cut(s)	42, 584
AfiI	CCNNNNNNNGG	1 cut(s)	145
AjnI	CCWGG	3 cut(s)	451, 601, 694
AluBI	AGCT	3 cut(s)	115, 550, 575
AluI	AGCT	3 cut(s)	115, 550, 575
Alw26I	GTCTC	1 cut(s)	308
AlwI	GGATC	1 cut(s)	427
AoxI	GGCC	5 cut(s)	108, 187, 254, 440, 646
ApeKI	GCWGC	1 cut(s)	756
ApoI	RAATTY	1 cut(s)	719
AspS9I	GGNCC	4 cut(s)	51, 605, 647, 698
AsuHPI	GGTGA	2 cut(s)	372, 559
AvaII	GGWCC	3 cut(s)	51, 605, 698
BalI	TGGCCA	3 cut(s)	110, 189, 256
BauI	CACGAG	1 cut(s)	55
BbvI	GCAGC	1 cut(s)	768
BccI	CCATC	4 cut(s)	139, 553, 587, 647
BciT130I	CCWGG	3 cut(s)	453, 603, 696
BcoDI	GTCTC	1 cut(s)	308
BisI	GCNGC	2 cut(s)	662, 757
BlpI	GCTNAGC	1 cut(s)	201
BlsI	GCNGC	2 cut(s)	663, 758
Bme1390I	CCNGG	3 cut(s)	453, 603, 696
Bme18I	GGWCC	3 cut(s)	51, 605, 698
BmgT120I	GGNCC	4 cut(s)	51, 605, 647, 698
BmrFI	CCNGG	3 cut(s)	453, 603, 696
BmrI	ACTGGG	1 cut(s)	438
BmsI	GCATC	2 cut(s)	115, 309
BmuI	ACTGGG	1 cut(s)	438
Bpu1102I	GCTNAGC	1 cut(s)	201
BpuEI	CTTGAG	1 cut(s)	749
BsaAI	YACGTR	1 cut(s)	44
BsaBI	GATNNNNATC	2 cut(s)	563, 597
BsaJI	CCNNGG	1 cut(s)	452
BsaWI	WCCGGW	1 cut(s)	700
Bsc4I	CCNNNNNNNGG	1 cut(s)	145
Bse1I	ACTGG	1 cut(s)	433
Bse8I	GATNNNNATC	2 cut(s)	563, 597
BseBI	CCWGG	3 cut(s)	453, 603, 696
BseDI	CCNNGG	1 cut(s)	452
BseGI	GGATG	4 cut(s)	74, 154, 340, 598
BseJI	GATNNNNATC	2 cut(s)	563, 597
BseLI	CCNNNNNNNGG	1 cut(s)	145
BseNI	ACTGG	1 cut(s)	433
BseRI	GAGGAG	1 cut(s)	172
BseXI	GCAGC	1 cut(s)	768
BshFI	GGCC	5 cut(s)	110, 189, 256, 442, 648
BsiSI	CCGG	1 cut(s)	701
BslI	CCNNNNNNNGG	1 cut(s)	145
BsmAI	GTCTC	1 cut(s)	308
BsmBI	CGTCTC	1 cut(s)	308
BsnI	GGCC	5 cut(s)	110, 189, 256, 442, 648
Bsp143I	GATC	2 cut(s)	419, 732
Bsp1720I	GCTNAGC	1 cut(s)	201
BspACI	CCGC	4 cut(s)	139, 158, 399, 662
BspANI	GGCC	5 cut(s)	110, 189, 256, 442, 648
BspHI	TCATGA	2 cut(s)	589, 773
BspPI	GGATC	1 cut(s)	427
BsrI	ACTGG	1 cut(s)	433
BssECI	CCNNGG	1 cut(s)	452
BssMI	GATC	2 cut(s)	419, 732
BssSI	CACGAG	1 cut(s)	55
Bst2BI	CACGAG	1 cut(s)	55
Bst2UI	CCWGG	3 cut(s)	453, 603, 696
Bst4CI	ACNGT	3 cut(s)	246, 518, 587
BstBAI	YACGTR	1 cut(s)	44
BstC8I	GCNNGC	1 cut(s)	692
BstDEI	CTNAG	1 cut(s)	201
BstF5I	GGATG	4 cut(s)	74, 154, 340, 598
BstKTI	GATC	2 cut(s)	422, 735
BstMAI	GTCTC	1 cut(s)	308
BstMBI	GATC	2 cut(s)	419, 732
BstMWI	GCNNNNNNNGC	2 cut(s)	67, 640
BstNI	CCWGG	3 cut(s)	453, 603, 696
BstNSI	RCATGY	1 cut(s)	694
BstSCI	CCNGG	3 cut(s)	451, 601, 694
BstSNI	TACGTA	1 cut(s)	44
BstV1I	GCAGC	1 cut(s)	768
BsuRI	GGCC	5 cut(s)	110, 189, 256, 442, 648
BtsCI	GGATG	4 cut(s)	74, 154, 340, 598
BtsI	GCAGTG	1 cut(s)	324
BtsIMutI	CAGTG	2 cut(s)	324, 426
Cac8I	GCNNGC	1 cut(s)	692
CciI	TCATGA	2 cut(s)	589, 773
Cfr13I	GGNCC	4 cut(s)	51, 605, 647, 698
Csp6I	GTAC	2 cut(s)	41, 583
CviAII	CATG	5 cut(s)	423, 491, 590, 691, 774
CviQI	GTAC	2 cut(s)	41, 583
DdeI	CTNAG	1 cut(s)	201
DpnI	GATC	2 cut(s)	421, 734
DpnII	GATC	2 cut(s)	419, 732
DrdI	GACNNNNNNGTC	2 cut(s)	541, 603
DseDI	GACNNNNNNGTC	2 cut(s)	541, 603
EaeI	YGGCCR	3 cut(s)	108, 187, 254
Eco105I	TACGTA	1 cut(s)	44
Eco147I	AGGCCT	1 cut(s)	442
Eco32I	GATATC	1 cut(s)	565
Eco47I	GGWCC	3 cut(s)	51, 605, 698
Eco57I	CTGAAG	1 cut(s)	572
EcoRII	CCWGG	3 cut(s)	451, 601, 694
EcoRV	GATATC	1 cut(s)	565
EcoT22I	ATGCAT	1 cut(s)	492
Esp3I	CGTCTC	1 cut(s)	308
FaeI	CATG	5 cut(s)	426, 494, 593, 694, 777
FatI	CATG	5 cut(s)	422, 490, 589, 690, 773
FauI	CCCGC	1 cut(s)	392
FblI	GTMKAC	1 cut(s)	23
Fnu4HI	GCNGC	2 cut(s)	662, 757
FokI	GGATG	4 cut(s)	61, 161, 327, 585
Fsp4HI	GCNGC	2 cut(s)	662, 757
GluI	GCNGC	2 cut(s)	662, 757
HaeIII	GGCC	5 cut(s)	110, 189, 256, 442, 648
HapII	CCGG	1 cut(s)	701
Hin1II	CATG	5 cut(s)	426, 494, 593, 694, 777
HindIII	AAGCTT	1 cut(s)	573
HpaII	CCGG	1 cut(s)	701
HphI	GGTGA	2 cut(s)	372, 559
Hpy166II	GTNNAC	1 cut(s)	24
Hpy188I	TCNGA	1 cut(s)	79
Hpy188III	TCNNGA	3 cut(s)	131, 590, 774
Hpy8I	GTNNAC	1 cut(s)	24
HpyAV	CCTTC	1 cut(s)	389
HpyCH4III	ACNGT	3 cut(s)	246, 518, 587
HpyCH4IV	ACGT	1 cut(s)	43
HpyCH4V	TGCA	6 cut(s)	4, 426, 449, 490, 521, 690
HpyF10VI	GCNNNNNNNGC	2 cut(s)	67, 640
HpyF3I	CTNAG	1 cut(s)	201
HpySE526I	ACGT	1 cut(s)	43
Hsp92II	CATG	5 cut(s)	426, 494, 593, 694, 777
Kzo9I	GATC	2 cut(s)	419, 732
LmnI	GCTCC	2 cut(s)	120, 133
Lsp1109I	GCAGC	1 cut(s)	768
LweI	GCATC	2 cut(s)	115, 309
MaeII	ACGT	1 cut(s)	43
MalI	GATC	2 cut(s)	421, 734
MboI	GATC	2 cut(s)	419, 732
MboII	GAAGA	2 cut(s)	289, 762
MlsI	TGGCCA	3 cut(s)	110, 189, 256
MluCI	AATT	3 cut(s)	346, 530, 719
MluNI	TGGCCA	3 cut(s)	110, 189, 256
MnlI	CCTC	7 cut(s)	64, 94, 193, 233, 286, 453, 745
Mox20I	TGGCCA	3 cut(s)	110, 189, 256
Mph1103I	ATGCAT	1 cut(s)	492
MscI	TGGCCA	3 cut(s)	110, 189, 256
MseI	TTAA	2 cut(s)	282, 513
MslI	CAYNNNNRTG	1 cut(s)	123
Msp20I	TGGCCA	3 cut(s)	110, 189, 256
MspI	CCGG	1 cut(s)	701
MspR9I	CCNGG	3 cut(s)	453, 603, 696
MvaI	CCWGG	3 cut(s)	453, 603, 696
MwoI	GCNNNNNNNGC	2 cut(s)	67, 640
NdeII	GATC	2 cut(s)	419, 732
NlaIII	CATG	5 cut(s)	426, 494, 593, 694, 777
NsiI	ATGCAT	1 cut(s)	492
NspI	RCATGY	1 cut(s)	694
PaeI	GCATGC	1 cut(s)	694
PagI	TCATGA	2 cut(s)	589, 773
PceI	AGGCCT	1 cut(s)	442
PkrI	GCNGC	2 cut(s)	663, 758
Ppu21I	YACGTR	1 cut(s)	44
Psp6I	CCWGG	3 cut(s)	451, 601, 694
PspGI	CCWGG	3 cut(s)	451, 601, 694
PspPI	GGNCC	4 cut(s)	51, 605, 647, 698
RsaI	GTAC	2 cut(s)	42, 584
RsaNI	GTAC	2 cut(s)	41, 583
RseI	CAYNNNNRTG	1 cut(s)	123
SaqAI	TTAA	2 cut(s)	282, 513
SatI	GCNGC	2 cut(s)	662, 757
Sau3AI	GATC	2 cut(s)	419, 732
Sau96I	GGNCC	4 cut(s)	51, 605, 647, 698
ScrFI	CCNGG	3 cut(s)	453, 603, 696
SfaNI	GCATC	2 cut(s)	115, 309
SinI	GGWCC	3 cut(s)	51, 605, 698
SmiMI	CAYNNNNRTG	1 cut(s)	123
SmlI	CTYRAG	1 cut(s)	728
SmoI	CTYRAG	1 cut(s)	728
SnaBI	TACGTA	1 cut(s)	44
SphI	GCATGC	1 cut(s)	694
Sse9I	AATT	3 cut(s)	346, 530, 719
SseBI	AGGCCT	1 cut(s)	442
SsiI	CCGC	4 cut(s)	139, 158, 399, 662
SspI	AATATT	1 cut(s)	289
StuI	AGGCCT	1 cut(s)	442
StyD4I	CCNGG	3 cut(s)	451, 601, 694
TaaI	ACNGT	3 cut(s)	246, 518, 587
TaiI	ACGT	1 cut(s)	46
TaqI	TCGA	2 cut(s)	266, 545
TasI	AATT	3 cut(s)	346, 530, 719
TauI	GCSGC	1 cut(s)	664
Tru1I	TTAA	2 cut(s)	282, 513
Tru9I	TTAA	2 cut(s)	282, 513
TscAI	CASTG	2 cut(s)	331, 433
TseI	GCWGC	1 cut(s)	756
TspDTI	ATGAA	4 cut(s)	290, 408, 507, 762
TspGWI	ACGGA	1 cut(s)	298
TspRI	CASTG	2 cut(s)	331, 433
VpaK11BI	GGWCC	3 cut(s)	51, 605, 698
XapI	RAATTY	1 cut(s)	719
XceI	RCATGY	1 cut(s)	694
XmiI	GTMKAC	1 cut(s)	23
Zsp2I	ATGCAT	1 cut(s)	492

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.