Rmu_co8344733.1_g000001

Belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8344733.1
Physical Location & Seq
Reverse (-)
742 .. 1020
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8344733.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
gggccaaagggtgttctcattaacattgggaggggtcatcatgttgatgagcctgagttggtatctgcactgctagaaggccgattaggtggagctggccttgatgtgtatcaaaatgaaccagaagtaccagagcagctgtttggttttgaaaatgtggtgctcttgcctcatgcaggaagtggtactactgaaactcgcaatgcaatggctgaccttgttattgggaatcttgaggctcacttcttgaacaaaccattgctgacccctgtggtttaa

Protein Analysis

92

Amino Acids

9.76

Weight (kDa)

4.81

Isoelectric Point (pI)

30.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018503)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 129, 187
AfiI CCNNNNNNNGG 1 cut(s) 176
AgsI TTSAA 2 cut(s) 152, 250
AluBI AGCT 2 cut(s) 95, 139
AluI AGCT 2 cut(s) 95, 139
Alw21I GWGCWC 1 cut(s) 165
AoxI GGCC 3 cut(s) 2, 79, 97
ApeKI GCWGC 1 cut(s) 136
AspS9I GGNCC 1 cut(s) 2
BarI GAAGNNNNNNTAC 2 cut(s) 172, 204
Bbv12I GWGCWC 1 cut(s) 165
BbvI GCAGC 1 cut(s) 148
BfaI CTAG 1 cut(s) 74
BisI GCNGC 1 cut(s) 137
BlsI GCNGC 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 2
BpuEI CTTGAG 1 cut(s) 254
BsaBI GATNNNNATC 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 176
Bse3DI GCAATG 3 cut(s) 208, 213, 257
Bse8I GATNNNNATC 1 cut(s) 108
BseJI GATNNNNATC 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 176
BseMI GCAATG 3 cut(s) 208, 213, 257
BseMII CTCAG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 148
BsgI GTGCAG 1 cut(s) 51
BshFI GGCC 3 cut(s) 4, 81, 99
BsiHKAI GWGCWC 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 176
BsnI GGCC 3 cut(s) 4, 81, 99
Bsp1286I GDGCHC 1 cut(s) 165
BspANI GGCC 3 cut(s) 4, 81, 99
BspCNI CTCAG 1 cut(s) 46
BsrDI GCAATG 3 cut(s) 208, 213, 257
BstC8I GCNNGC 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 54
BstENI CCTNNNNNAGG 1 cut(s) 174
BstV1I GCAGC 1 cut(s) 148
BsuRI GGCC 3 cut(s) 4, 81, 99
BtsI GCAGTG 1 cut(s) 68
BtsIMutI CAGTG 1 cut(s) 68
Cac8I GCNNGC 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 2
Csp6I GTAC 2 cut(s) 128, 186
CviAII CATG 2 cut(s) 41, 173
CviJI RGCY 8 cut(s) 4, 52, 81, 95, 99, 139, 212, 239
CviKI_1 RGCY 8 cut(s) 4, 52, 81, 95, 99, 139, 212, 239
CviQI GTAC 2 cut(s) 128, 186
DdeI CTNAG 1 cut(s) 54
EcoNI CCTNNNNNAGG 1 cut(s) 174
FaeI CATG 2 cut(s) 44, 176
FaiI YATR 2 cut(s) 42, 174
FatI CATG 2 cut(s) 40, 172
Fnu4HI GCNGC 1 cut(s) 137
Fsp4HI GCNGC 1 cut(s) 137
FspBI CTAG 1 cut(s) 74
GluI GCNGC 1 cut(s) 137
HaeIII GGCC 3 cut(s) 4, 81, 99
Hin1II CATG 2 cut(s) 44, 176
HinfI GANTC 1 cut(s) 229
Hpy188III TCNNGA 2 cut(s) 233, 247
HpyAV CCTTC 1 cut(s) 71
HpyCH4V TGCA 3 cut(s) 68, 176, 206
HpyF3I CTNAG 1 cut(s) 54
Hsp92II CATG 2 cut(s) 44, 176
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 5 cut(s) 66, 81, 135, 144, 162
Lsp1109I GCAGC 1 cut(s) 148
MaeI CTAG 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 165
MnlI CCTC 3 cut(s) 24, 180, 229
MseI TTAA 2 cut(s) 21, 277
MslI CAYNNNNRTG 1 cut(s) 45
MspA1I CMGCKG 1 cut(s) 139
NlaIII CATG 2 cut(s) 44, 176
PfeI GAWTC 1 cut(s) 229
PkrI GCNGC 1 cut(s) 138
PspPI GGNCC 1 cut(s) 2
PsrI GAACNNNNNNTAC 2 cut(s) 111, 143
PvuII CAGCTG 1 cut(s) 139
RsaI GTAC 2 cut(s) 129, 187
RsaNI GTAC 2 cut(s) 128, 186
RseI CAYNNNNRTG 1 cut(s) 45
SaqAI TTAA 2 cut(s) 21, 277
SatI GCNGC 1 cut(s) 137
Sau96I GGNCC 1 cut(s) 2
SduI GDGCHC 1 cut(s) 165
SetI ASST 4 cut(s) 91, 97, 141, 219
SmiMI CAYNNNNRTG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
SspMI CTAG 1 cut(s) 74
TfiI GAWTC 1 cut(s) 229
Tru1I TTAA 2 cut(s) 21, 277
Tru9I TTAA 2 cut(s) 21, 277
TscAI CASTG 1 cut(s) 75
TseI GCWGC 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 132
TspRI CASTG 1 cut(s) 75
XagI CCTNNNNNAGG 1 cut(s) 174
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.