Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8363147.1

Orthogroup ID

OG0008841

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 980

Gene Structure 979 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8363147.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 979 bp

atgattgatgggtatgcggggtgtggttattcgaatgaggctgtggagttgtttgatgagatgttgttcagtgatgttgagccaaatgaggttactatgattgcagtgctttcggcgggctcgaataagggggatattggtatggggaagagtattcacgagtatgtgcgaaagaaggatgtgaactgtagcttgaatttgcttaatgctttgttggatatgtatgtgaaatgtggttgtttgactacggcgaaggaggtttttgatgacatgaaagtgagggatgtgtttacatggactagcatggttaatggatatgctaaatgcggcgagttagacgctgcaagacagttttttaatgacatgcctgatagaaatgtagtatcttggaatgcaatgattgctggttatgctcagaacaatcaacctactgaagcggtgaagttgtttcatgacatggtggagtcgggttttgctccgatagagaacagtttagtatgtgtgctctctgcttgtggtcagttaagttgcctggatttgggtcggtggattcaccagtattatgtccatggaaatcatattcaacttggtgtgattttggggaatgcgttgatagacatgtatgccaagtgtgggagtttaacttctgctacagaacttttcaatgaaatgccagagaaaaatttggtttcttggaatacgatgattgctggatacgctgctcatggccatgctaagcaagctcttactctattcaaccaaatgaaaagtacggatacgaagcctgaccatatcacatttgtggcagtcttgtctgcttgcagccatggcggattagtttctgaaggcagagagcatttcaaaagcatgattagggattacggaatagagcccaaagaggaaaattatgcttgcatgatagatttacttggaagaattggattgctggaagaagcatatgagttgataaacaaaatgc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

326

Amino Acids

36.11

Weight (kDa)

4.99

Isoelectric Point (pI)

37.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008841)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g24540
malus_domestica	MD11G1296500.v1.1
prunus_persica	Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1
pyrus_communis	pycom11g26090
rosa_chinensis	RchiOBHm_Chr6g0292361
rosa_laevigata	RLG00000012036
rosa_multiflora	Rmu_co8363147.1_g000001 Rmu_sc0001354.1_g000011 Rmu_sc0011092.1_g000001
rosa_roxburghii	Rroxscaffold_7G00175140
rosa_rugosa	Rorug06G0225900
rosa_samantha	Rh6BG346500
rosa_wichuraiana	Rw6G029520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	5 cut(s)	17, 116, 327, 437, 831
AcoI	YGGCCR	1 cut(s)	727
AcsI	RAATTY	2 cut(s)	196, 682
AcuI	CTGAAG	2 cut(s)	453, 864
AfaI	GTAC	1 cut(s)	772
AfiI	CCNNNNNNNGG	2 cut(s)	538, 633
AflIII	ACRYGT	1 cut(s)	618
AgsI	TTSAA	5 cut(s)	196, 584, 664, 757, 862
AjnI	CCWGG	1 cut(s)	531
AleI	CACNNNNGTG	1 cut(s)	800
AluBI	AGCT	2 cut(s)	192, 743
AluI	AGCT	2 cut(s)	192, 743
Alw21I	GWGCWC	1 cut(s)	507
AoxI	GGCC	1 cut(s)	727
ApeKI	GCWGC	3 cut(s)	341, 719, 822
ApoI	RAATTY	2 cut(s)	196, 682
AsuHPI	GGTGA	2 cut(s)	451, 545
AsuII	TTCGAA	1 cut(s)	32
BalI	TGGCCA	1 cut(s)	729
BanII	GRGCYC	2 cut(s)	122, 894
BauI	CACGAG	1 cut(s)	158
Bbv12I	GWGCWC	1 cut(s)	507
BbvI	GCAGC	3 cut(s)	328, 706, 834
BccI	CCATC	1 cut(s)	2
BceAI	ACGGC	1 cut(s)	264
BcgI	CGANNNNNNTGC	2 cut(s)	93, 127
BciT130I	CCWGG	1 cut(s)	533
BciVI	GTATCC	2 cut(s)	707, 769
BfaI	CTAG	1 cut(s)	300
BfmI	CTRYAG	2 cut(s)	187, 651
BfuI	GTATCC	2 cut(s)	707, 769
BisI	GCNGC	4 cut(s)	328, 342, 720, 823
BlpI	GCTNAGC	1 cut(s)	735
BlsI	GCNGC	4 cut(s)	329, 343, 721, 824
Bme1390I	CCNGG	1 cut(s)	533
BmrFI	CCNGG	1 cut(s)	533
Bpu1102I	GCTNAGC	1 cut(s)	735
Bpu14I	TTCGAA	1 cut(s)	32
BsaJI	CCNNGG	2 cut(s)	568, 826
Bsc4I	CCNNNNNNNGG	2 cut(s)	538, 633
Bse1I	ACTGG	1 cut(s)	556
Bse3DI	GCAATG	1 cut(s)	402
BseBI	CCWGG	1 cut(s)	533
BseDI	CCNNGG	2 cut(s)	568, 826
BseGI	GGATG	2 cut(s)	184, 289
BseLI	CCNNNNNNNGG	2 cut(s)	538, 633
BseMI	GCAATG	1 cut(s)	402
BseMII	CTCAG	1 cut(s)	428
BseNI	ACTGG	1 cut(s)	556
BseXI	GCAGC	3 cut(s)	328, 706, 834
BshFI	GGCC	1 cut(s)	729
BsiHKAI	GWGCWC	1 cut(s)	507
BslI	CCNNNNNNNGG	2 cut(s)	538, 633
BsmI	GAATGC	2 cut(s)	397, 610
BsnI	GGCC	1 cut(s)	729
Bsp119I	TTCGAA	1 cut(s)	32
Bsp1286I	GDGCHC	3 cut(s)	122, 507, 894
Bsp1720I	GCTNAGC	1 cut(s)	735
Bsp19I	CCATGG	2 cut(s)	568, 826
BspACI	CCGC	5 cut(s)	17, 116, 327, 437, 831
BspANI	GGCC	1 cut(s)	729
BspCNI	CTCAG	1 cut(s)	427
BspHI	TCATGA	1 cut(s)	451
BspT104I	TTCGAA	1 cut(s)	32
BsrDI	GCAATG	1 cut(s)	402
BsrI	ACTGG	1 cut(s)	556
BssECI	CCNNGG	2 cut(s)	568, 826
BssSI	CACGAG	1 cut(s)	158
BssT1I	CCWWGG	2 cut(s)	568, 826
Bst2BI	CACGAG	1 cut(s)	158
Bst2UI	CCWGG	1 cut(s)	533
Bst4CI	ACNGT	3 cut(s)	188, 351, 491
Bst6I	CTCTTC	1 cut(s)	143
BstAPI	GCANNNNNTGC	1 cut(s)	401
BstBI	TTCGAA	1 cut(s)	32
BstC8I	GCNNGC	4 cut(s)	118, 741, 820, 913
BstDEI	CTNAG	2 cut(s)	414, 735
BstDSI	CCRYGG	2 cut(s)	568, 826
BstF5I	GGATG	2 cut(s)	184, 289
BstMWI	GCNNNNNNNGC	5 cut(s)	401, 410, 716, 740, 828
BstNI	CCWGG	1 cut(s)	533
BstNSI	RCATGY	2 cut(s)	367, 622
BstSCI	CCNGG	1 cut(s)	531
BstSFI	CTRYAG	2 cut(s)	187, 651
BstV1I	GCAGC	3 cut(s)	328, 706, 834
BsuI	GTATCC	2 cut(s)	707, 769
BsuRI	GGCC	1 cut(s)	729
BtgI	CCRYGG	2 cut(s)	568, 826
BtsCI	GGATG	2 cut(s)	184, 289
BtsI	GCAGTG	1 cut(s)	111
BtsIMutI	CAGTG	2 cut(s)	76, 111
Cac8I	GCNNGC	4 cut(s)	118, 741, 820, 913
CciI	TCATGA	1 cut(s)	451
CseI	GACGC	1 cut(s)	347
Csp6I	GTAC	1 cut(s)	771
CviJI	RGCY	9 cut(s)	41, 82, 120, 192, 729, 743, 784, 825, 892
CviKI_1	RGCY	9 cut(s)	41, 82, 120, 192, 729, 743, 784, 825, 892
CviQI	GTAC	1 cut(s)	771
DdeI	CTNAG	2 cut(s)	414, 735
EaeI	YGGCCR	1 cut(s)	727
Eam1104I	CTCTTC	1 cut(s)	143
EarI	CTCTTC	1 cut(s)	143
EciI	GGCGGA	1 cut(s)	846
Eco130I	CCWWGG	2 cut(s)	568, 826
Eco24I	GRGCYC	2 cut(s)	122, 894
Eco57I	CTGAAG	2 cut(s)	453, 864
EcoRII	CCWGG	1 cut(s)	531
EcoT14I	CCWWGG	2 cut(s)	568, 826
EcoT38I	GRGCYC	2 cut(s)	122, 894
ErhI	CCWWGG	2 cut(s)	568, 826
FauI	CCCGC	2 cut(s)	10, 109
FauNDI	CATATG	1 cut(s)	958
Fnu4HI	GCNGC	4 cut(s)	328, 342, 720, 823
FokI	GGATG	2 cut(s)	191, 296
FriOI	GRGCYC	2 cut(s)	122, 894
Fsp4HI	GCNGC	4 cut(s)	328, 342, 720, 823
FspBI	CTAG	1 cut(s)	300
GluI	GCNGC	4 cut(s)	328, 342, 720, 823
HaeIII	GGCC	1 cut(s)	729
HgaI	GACGC	1 cut(s)	347
HinfI	GANTC	2 cut(s)	464, 550
HphI	GGTGA	2 cut(s)	451, 545
Hpy166II	GTNNAC	2 cut(s)	184, 291
Hpy188I	TCNGA	3 cut(s)	417, 480, 844
Hpy188III	TCNNGA	2 cut(s)	158, 452
Hpy8I	GTNNAC	2 cut(s)	184, 291
HpyAV	CCTTC	3 cut(s)	169, 247, 839
HpyCH4III	ACNGT	3 cut(s)	188, 351, 491
HpyCH4V	TGCA	5 cut(s)	104, 344, 395, 822, 915
HpyF10VI	GCNNNNNNNGC	5 cut(s)	401, 410, 716, 740, 828
HpyF3I	CTNAG	2 cut(s)	414, 735
LmnI	GCTCC	1 cut(s)	481
LpnPI	CCDG	9 cut(s)	381, 390, 518, 545, 569, 687, 696, 798, 932
Lsp1109I	GCAGC	3 cut(s)	328, 706, 834
MaeI	CTAG	1 cut(s)	300
MaeIII	GTNAC	1 cut(s)	91
MboII	GAAGA	3 cut(s)	160, 945, 962
MhlI	GDGCHC	3 cut(s)	122, 507, 894
MlsI	TGGCCA	1 cut(s)	729
MluCI	AATT	4 cut(s)	196, 682, 904, 936
MluNI	TGGCCA	1 cut(s)	729
MlyI	GAGTC	1 cut(s)	473
MmeI	TCCRAC	1 cut(s)	195
MnlI	CCTC	5 cut(s)	31, 82, 250, 273, 892
Mox20I	TGGCCA	1 cut(s)	729
MscI	TGGCCA	1 cut(s)	729
MseI	TTAA	5 cut(s)	204, 309, 357, 524, 641
MslI	CAYNNNNRTG	4 cut(s)	162, 275, 729, 800
Msp20I	TGGCCA	1 cut(s)	729
MspR9I	CCNGG	1 cut(s)	533
Mva1269I	GAATGC	2 cut(s)	397, 610
MvaI	CCWGG	1 cut(s)	533
MwoI	GCNNNNNNNGC	5 cut(s)	401, 410, 716, 740, 828
NcoI	CCATGG	2 cut(s)	568, 826
NdeI	CATATG	1 cut(s)	958
NspI	RCATGY	2 cut(s)	367, 622
NspV	TTCGAA	1 cut(s)	32
OliI	CACNNNNGTG	1 cut(s)	800
PagI	TCATGA	1 cut(s)	451
PciI	ACATGT	1 cut(s)	618
PcsI	WCGNNNNNNNCGW	1 cut(s)	119
PctI	GAATGC	2 cut(s)	397, 610
PfeI	GAWTC	1 cut(s)	550
PkrI	GCNGC	4 cut(s)	329, 343, 721, 824
PleI	GAGTC	1 cut(s)	472
PpsI	GAGTC	1 cut(s)	472
PscI	ACATGT	1 cut(s)	618
Psp6I	CCWGG	1 cut(s)	531
PspGI	CCWGG	1 cut(s)	531
RsaI	GTAC	1 cut(s)	772
RsaNI	GTAC	1 cut(s)	771
RseI	CAYNNNNRTG	4 cut(s)	162, 275, 729, 800
SaqAI	TTAA	5 cut(s)	204, 309, 357, 524, 641
SatI	GCNGC	4 cut(s)	328, 342, 720, 823
SchI	GAGTC	1 cut(s)	473
ScrFI	CCNGG	1 cut(s)	533
SduI	GDGCHC	3 cut(s)	122, 507, 894
SetI	ASST	5 cut(s)	93, 194, 261, 430, 745
SfcI	CTRYAG	2 cut(s)	187, 651
SfuI	TTCGAA	1 cut(s)	32
SmiMI	CAYNNNNRTG	4 cut(s)	162, 275, 729, 800
Sse9I	AATT	4 cut(s)	196, 682, 904, 936
SsiI	CCGC	5 cut(s)	17, 116, 327, 437, 831
SspMI	CTAG	1 cut(s)	300
StyD4I	CCNGG	1 cut(s)	531
StyI	CCWWGG	2 cut(s)	568, 826
TaaI	ACNGT	3 cut(s)	188, 351, 491
TaqI	TCGA	2 cut(s)	32, 122
TasI	AATT	4 cut(s)	196, 682, 904, 936
TauI	GCSGC	1 cut(s)	330
TfiI	GAWTC	1 cut(s)	550
Tru1I	TTAA	5 cut(s)	204, 309, 357, 524, 641
Tru9I	TTAA	5 cut(s)	204, 309, 357, 524, 641
TscAI	CASTG	2 cut(s)	76, 111
TseI	GCWGC	3 cut(s)	341, 719, 822
TspDTI	ATGAA	4 cut(s)	287, 440, 681, 779
TspGWI	ACGGA	2 cut(s)	788, 897
TspRI	CASTG	2 cut(s)	76, 111
XapI	RAATTY	2 cut(s)	196, 682
XceI	RCATGY	2 cut(s)	367, 622
XspI	CTAG	1 cut(s)	300

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.