Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011092.1

Orthogroup ID

OG0008841

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1830

Gene Structure 1829 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011092.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1829 bp

atgaagtcccgcttccactctctgttctctgcgcagactcacagaccccaagtcctccactcacttcatcagcgaccaatctcatcaccctcagccaataaacccaaatggaactccaagaccaacgtcataatcaccaacccaactctgctcatcatggagtcttgcaccaccatgctccagttgaagcaaattcaagcccaaatgacctgcactggcctcattcaccacacctttcccgtcagcagagtcctagccttctgtgctatcgccgacggcggcgacattcactacgctaatcttattttcacgcgcattgcaaaacccaatacttatatgtggaacacaatgatcagaggctactccaaagctcaagttaacacaactggattctcatttttctgccgaatggtccgcgaacgtgtcgaaatggactgccggagttttgtctttgcgcttaaggcatgtgggttgctgggcgattcggtacattgcgtgatttggaagatgggttttgggtctgactcgctggtgcgaaatgggttggtgcattattatgctgaaggcgggtccgtgagtcatgcacggaaggtgttcgatgaaagtcctgtgagggatgttgtaacttggaccaccatgattgatgggtatgcggggtgtggttattcgaatgaggctgtggagttgtttgatgagatgttgttcagtgatgttgagccaaatgaggttactatgattgcagtgctttcggcgtgctcgaataagggggatattggtatggggaagagtattcacgagtatgtgcgaaagaaggatgtgaactgtagcttgaatttgcttaatgctttgttggatatgtatgtgaaatgtggttgtttgactgcggcgaaagaggtttttgatgacatgaaagtgagggatgtgtttacatggactagcatggttaatggatatgctaaatgcggcgagttagacgctgcaagacagttttttaatgacatgcctgatagaaatgtagtatcttggaatgcaatgattgctggttatgctcagaacaatcaacctactgaagcggtgaagttgtttcatgacatggtggagtcgggttttgctccgatagagaacagtttagtatgtgtgctctctgcttgtggtcagttaagttgcctggatttgggtcggtggattcaccagtattatgtccatggaaatcatattcaacttggtgtgattttggggaatgcgttgatagacatgtatgccaagtgtgggagtttaacttctgctacagaacttttcaatgaaatgccagagaaaaacttggtttcttggaatacgatgattgctggatacgctgctcatggccatgctaagcaagctcttactctattcaaccaaatgaaaagtacggatacgaagcctgaccatatcacatttgtggcagtcttgtctgcttgcagccatggcggattagtttctgaaggcagagagcatttcaaaagcatgattagggattacggaatagagcccaaagaggaaaattatgcttgcatgatagatttacttggaagaattggattgctggaagaagcatatgagttgataaacaaaatgccaatggaaccgagtgcgtctgcatggggcgcccttctaaattcatgtaaaattcatgggaatgttgagctagctaagctttctgctgagaaactattagacttggacccagaagatagcggaatttatgtgtcgctggcaaacttatgcgctatcaagcaaagatgggtggatgtaagaaatgtcagaagcctgatgaaagagaggggagtgca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

609

Amino Acids

67.83

Weight (kDa)

6.49

Isoelectric Point (pI)

40.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008841)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g24540
malus_domestica	MD11G1296500.v1.1
prunus_persica	Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1 Prupe.1G201400_v2.0.a1
pyrus_communis	pycom11g26090
rosa_chinensis	RchiOBHm_Chr6g0292361
rosa_laevigata	RLG00000012036
rosa_multiflora	Rmu_co8363147.1_g000001 Rmu_sc0001354.1_g000011 Rmu_sc0011092.1_g000001
rosa_roxburghii	Rroxscaffold_7G00175140
rosa_rugosa	Rorug06G0225900
rosa_samantha	Rh6BG346500
rosa_wichuraiana	Rw6G029520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	33
Acc36I	ACCTGC	1 cut(s)	218
AccB1I	GGYRCC	1 cut(s)	1643
AccII	CGCG	2 cut(s)	313, 417
AcoI	YGGCCR	1 cut(s)	1363
AcsI	RAATTY	5 cut(s)	192, 832, 1654, 1665, 1737
AcuI	CTGAAG	3 cut(s)	582, 1089, 1500
AcyI	GRCGYC	1 cut(s)	1644
AfaI	GTAC	2 cut(s)	489, 1408
AfiI	CCNNNNNNNGG	2 cut(s)	1174, 1269
AflII	CTTAAG	1 cut(s)	458
AflIII	ACRYGT	2 cut(s)	421, 1254
AgsI	TTSAA	7 cut(s)	187, 197, 832, 1220, 1300, 1393, 1498
AhdI	GACNNNNNGTC	1 cut(s)	50
AjnI	CCWGG	1 cut(s)	1167
AleI	CACNNNNGTG	1 cut(s)	1436
AluBI	AGCT	6 cut(s)	371, 828, 1379, 1684, 1688, 1693
AluI	AGCT	6 cut(s)	371, 828, 1379, 1684, 1688, 1693
Alw21I	GWGCWC	2 cut(s)	758, 1143
AoxI	GGCC	2 cut(s)	217, 1363
ApeKI	GCWGC	3 cut(s)	977, 1355, 1458
ApoI	RAATTY	5 cut(s)	192, 832, 1654, 1665, 1737
Asp700I	GAANNNNTTC	1 cut(s)	593
AspLEI	GCGC	5 cut(s)	34, 315, 457, 1646, 1766
AspS9I	GGNCC	4 cut(s)	412, 570, 630, 1720
AsuHPI	GGTGA	5 cut(s)	78, 127, 218, 1087, 1181
AsuII	TTCGAA	1 cut(s)	668
AsuNHI	GCTAGC	1 cut(s)	1684
AvaII	GGWCC	4 cut(s)	412, 570, 630, 1720
BalI	TGGCCA	1 cut(s)	1365
BanI	GGYRCC	1 cut(s)	1643
BanII	GRGCYC	1 cut(s)	1530
BauI	CACGAG	1 cut(s)	794
Bbv12I	GWGCWC	2 cut(s)	758, 1143
BbvCI	CCTCAGC	1 cut(s)	91
BbvI	GCAGC	3 cut(s)	964, 1342, 1470
BccI	CCATC	3 cut(s)	502, 638, 1773
BceAI	ACGGC	1 cut(s)	292
BcgI	CGANNNNNNTGC	2 cut(s)	729, 763
BciT130I	CCWGG	1 cut(s)	1169
BciVI	GTATCC	2 cut(s)	1343, 1405
BclI	TGATCA	1 cut(s)	351
BfaI	CTAG	3 cut(s)	254, 936, 1685
BfmI	CTRYAG	2 cut(s)	823, 1287
BfoI	RGCGCY	1 cut(s)	1647
BfrI	CTTAAG	1 cut(s)	458
BfuAI	ACCTGC	1 cut(s)	218
BfuI	GTATCC	2 cut(s)	1343, 1405
BisI	GCNGC	6 cut(s)	280, 885, 964, 978, 1356, 1459
BlpI	GCTNAGC	2 cut(s)	1371, 1689
BlsI	GCNGC	6 cut(s)	281, 886, 965, 979, 1357, 1460
Bme1390I	CCNGG	1 cut(s)	1169
Bme18I	GGWCC	4 cut(s)	412, 570, 630, 1720
BmeRI	GACNNNNNGTC	1 cut(s)	50
BmgT120I	GGNCC	4 cut(s)	412, 570, 630, 1720
BmiI	GGNNCC	4 cut(s)	571, 1623, 1645, 1722
BmrFI	CCNGG	1 cut(s)	1169
BmtI	GCTAGC	1 cut(s)	1688
BoxI	GACNNNNGTC	1 cut(s)	125
BpmI	CTGGAG	1 cut(s)	164
Bpu10I	CCTNAGC	1 cut(s)	91
Bpu1102I	GCTNAGC	2 cut(s)	1371, 1689
Bpu14I	TTCGAA	1 cut(s)	668
BpuEI	CTTGAG	1 cut(s)	357
BsaHI	GRCGYC	1 cut(s)	1644
BsaJI	CCNNGG	2 cut(s)	1204, 1462
Bsc4I	CCNNNNNNNGG	2 cut(s)	1174, 1269
Bse1I	ACTGG	4 cut(s)	181, 220, 391, 1192
Bse3DI	GCAATG	3 cut(s)	315, 490, 1038
BseBI	CCWGG	1 cut(s)	1169
BseDI	CCNNGG	2 cut(s)	1204, 1462
BseGI	GGATG	4 cut(s)	622, 820, 925, 1792
BseLI	CCNNNNNNNGG	2 cut(s)	1174, 1269
BseMI	GCAATG	3 cut(s)	315, 490, 1038
BseMII	CTCAG	3 cut(s)	105, 1064, 1692
BseNI	ACTGG	4 cut(s)	181, 220, 391, 1192
BseXI	GCAGC	3 cut(s)	964, 1342, 1470
BseYI	CCCAGC	1 cut(s)	475
BsgI	GTGCAG	1 cut(s)	196
Bsh1236I	CGCG	2 cut(s)	313, 417
BshFI	GGCC	2 cut(s)	219, 1365
BshNI	GGYRCC	1 cut(s)	1643
BsiHKAI	GWGCWC	2 cut(s)	758, 1143
BsiSI	CCGG	1 cut(s)	439
BslI	CCNNNNNNNGG	2 cut(s)	1174, 1269
BsmI	GAATGC	2 cut(s)	1033, 1246
BsnI	GGCC	2 cut(s)	219, 1365
Bsp119I	TTCGAA	1 cut(s)	668
Bsp1286I	GDGCHC	3 cut(s)	758, 1143, 1530
Bsp143I	GATC	1 cut(s)	351
Bsp1720I	GCTNAGC	2 cut(s)	1371, 1689
Bsp19I	CCATGG	2 cut(s)	1204, 1462
BspANI	GGCC	2 cut(s)	219, 1365
BspCNI	CTCAG	3 cut(s)	104, 1063, 1693
BspFNI	CGCG	2 cut(s)	313, 417
BspHI	TCATGA	1 cut(s)	1087
BspLI	GGNNCC	4 cut(s)	571, 1623, 1645, 1722
BspMI	ACCTGC	1 cut(s)	218
BspOI	GCTAGC	1 cut(s)	1688
BspT104I	TTCGAA	1 cut(s)	668
BspT107I	GGYRCC	1 cut(s)	1643
BspTI	CTTAAG	1 cut(s)	458
BsrDI	GCAATG	3 cut(s)	315, 490, 1038
BsrI	ACTGG	4 cut(s)	181, 220, 391, 1192
BssECI	CCNNGG	2 cut(s)	1204, 1462
BssMI	GATC	1 cut(s)	351
BssNI	GRCGYC	1 cut(s)	1644
BssSI	CACGAG	1 cut(s)	794
BssT1I	CCWWGG	2 cut(s)	1204, 1462
Bst2BI	CACGAG	1 cut(s)	794
Bst2UI	CCWGG	1 cut(s)	1169
Bst4CI	ACNGT	3 cut(s)	824, 987, 1127
Bst6I	CTCTTC	1 cut(s)	779
BstACI	GRCGYC	1 cut(s)	1644
BstAFI	CTTAAG	1 cut(s)	458
BstAPI	GCANNNNNTGC	1 cut(s)	1037
BstBI	TTCGAA	1 cut(s)	668
BstC8I	GCNNGC	6 cut(s)	754, 1377, 1456, 1549, 1686, 1752
BstDEI	CTNAG	5 cut(s)	91, 1050, 1371, 1689, 1701
BstDSI	CCRYGG	2 cut(s)	1204, 1462
BstF5I	GGATG	4 cut(s)	622, 820, 925, 1792
BstFNI	CGCG	2 cut(s)	313, 417
BstH2I	RGCGCY	1 cut(s)	1647
BstHHI	GCGC	5 cut(s)	34, 315, 457, 1646, 1766
BstKTI	GATC	1 cut(s)	354
BstMBI	GATC	1 cut(s)	351
BstMWI	GCNNNNNNNGC	9 cut(s)	263, 461, 1037, 1046, 1352, 1376, 1464, 1643, 1690
BstNI	CCWGG	1 cut(s)	1169
BstNSI	RCATGY	3 cut(s)	468, 1003, 1258
BstPAI	GACNNNNGTC	1 cut(s)	125
BstSCI	CCNGG	1 cut(s)	1167
BstSFI	CTRYAG	2 cut(s)	823, 1287
BstUI	CGCG	2 cut(s)	313, 417
BstV1I	GCAGC	3 cut(s)	964, 1342, 1470
BsuI	GTATCC	2 cut(s)	1343, 1405
BsuRI	GGCC	2 cut(s)	219, 1365
BtgI	CCRYGG	2 cut(s)	1204, 1462
BtsCI	GGATG	4 cut(s)	622, 820, 925, 1792
BtsI	GCAGTG	1 cut(s)	747
BtsIMutI	CAGTG	3 cut(s)	213, 712, 747
BveI	ACCTGC	1 cut(s)	218
Cac8I	GCNNGC	6 cut(s)	754, 1377, 1456, 1549, 1686, 1752
CciI	TCATGA	1 cut(s)	1087
CfoI	GCGC	5 cut(s)	34, 315, 457, 1646, 1766
Cfr13I	GGNCC	4 cut(s)	412, 570, 630, 1720
CseI	GACGC	2 cut(s)	983, 1620
Csp6I	GTAC	2 cut(s)	488, 1407
CspCI	CAANNNNNGTGG	2 cut(s)	622, 657
CviQI	GTAC	2 cut(s)	488, 1407
DdeI	CTNAG	5 cut(s)	91, 1050, 1371, 1689, 1701
DinI	GGCGCC	1 cut(s)	1645
DpnI	GATC	1 cut(s)	353
DpnII	GATC	1 cut(s)	351
DriI	GACNNNNNGTC	1 cut(s)	50
EaeI	YGGCCR	1 cut(s)	1363
Eam1104I	CTCTTC	1 cut(s)	779
Eam1105I	GACNNNNNGTC	1 cut(s)	50
EarI	CTCTTC	1 cut(s)	779
EciI	GGCGGA	1 cut(s)	1482
Eco130I	CCWWGG	2 cut(s)	1204, 1462
Eco24I	GRGCYC	1 cut(s)	1530
Eco47I	GGWCC	4 cut(s)	412, 570, 630, 1720
Eco57I	CTGAAG	3 cut(s)	582, 1089, 1500
EcoRII	CCWGG	1 cut(s)	1167
EcoT14I	CCWWGG	2 cut(s)	1204, 1462
EcoT38I	GRGCYC	1 cut(s)	1530
EgeI	GGCGCC	1 cut(s)	1645
EheI	GGCGCC	1 cut(s)	1645
ErhI	CCWWGG	2 cut(s)	1204, 1462
FalI	AAGNNNNNCTT	1 cut(s)	28
FauI	CCCGC	3 cut(s)	17, 560, 646
FauNDI	CATATG	1 cut(s)	1594
FbaI	TGATCA	1 cut(s)	351
Fnu4HI	GCNGC	6 cut(s)	280, 885, 964, 978, 1356, 1459
FokI	GGATG	4 cut(s)	629, 827, 932, 1799
FriOI	GRGCYC	1 cut(s)	1530
Fsp4HI	GCNGC	6 cut(s)	280, 885, 964, 978, 1356, 1459
FspBI	CTAG	3 cut(s)	254, 936, 1685
FspI	TGCGCA	1 cut(s)	33
GlaI	GCGC	5 cut(s)	33, 314, 456, 1645, 1765
GluI	GCNGC	6 cut(s)	280, 885, 964, 978, 1356, 1459
GsaI	CCCAGC	1 cut(s)	479
GsuI	CTGGAG	1 cut(s)	164
HaeII	RGCGCY	1 cut(s)	1647
HaeIII	GGCC	2 cut(s)	219, 1365
HapII	CCGG	1 cut(s)	439
HgaI	GACGC	2 cut(s)	983, 1620
HhaI	GCGC	5 cut(s)	34, 315, 457, 1646, 1766
Hin1I	GRCGYC	1 cut(s)	1644
Hin6I	GCGC	5 cut(s)	32, 313, 455, 1644, 1764
HinP1I	GCGC	5 cut(s)	32, 313, 455, 1644, 1764
HincII	GTYRAC	1 cut(s)	379
HindII	GTYRAC	1 cut(s)	379
HindIII	AAGCTT	1 cut(s)	1691
HinfI	GANTC	9 cut(s)	37, 161, 249, 390, 482, 524, 577, 1100, 1186
HpaI	GTTAAC	1 cut(s)	379
HpaII	CCGG	1 cut(s)	439
HphI	GGTGA	5 cut(s)	78, 127, 218, 1087, 1181
Hpy166II	GTNNAC	3 cut(s)	379, 820, 927
Hpy188I	TCNGA	6 cut(s)	356, 523, 1053, 1116, 1480, 1802
Hpy188III	TCNNGA	2 cut(s)	794, 1088
Hpy8I	GTNNAC	3 cut(s)	379, 820, 927
Hpy99I	CGWCG	1 cut(s)	278
HpyAV	CCTTC	6 cut(s)	268, 557, 583, 805, 1475, 1658
HpyCH4III	ACNGT	3 cut(s)	824, 987, 1127
HpyCH4IV	ACGT	2 cut(s)	126, 421
HpyF10VI	GCNNNNNNNGC	9 cut(s)	263, 461, 1037, 1046, 1352, 1376, 1464, 1643, 1690
HpyF3I	CTNAG	5 cut(s)	91, 1050, 1371, 1689, 1701
HpySE526I	ACGT	2 cut(s)	126, 421
Hsp92I	GRCGYC	1 cut(s)	1644
HspAI	GCGC	5 cut(s)	32, 313, 455, 1644, 1764
KasI	GGCGCC	1 cut(s)	1643
Ksp22I	TGATCA	1 cut(s)	351
KspAI	GTTAAC	1 cut(s)	379
Kzo9I	GATC	1 cut(s)	351
LmnI	GCTCC	2 cut(s)	183, 1117
Lsp1109I	GCAGC	3 cut(s)	964, 1342, 1470
MaeI	CTAG	3 cut(s)	254, 936, 1685
MaeII	ACGT	2 cut(s)	126, 421
MaeIII	GTNAC	2 cut(s)	622, 727
MalI	GATC	1 cut(s)	353
MboI	GATC	1 cut(s)	351
MboII	GAAGA	5 cut(s)	517, 796, 1581, 1598, 1739
MhlI	GDGCHC	3 cut(s)	758, 1143, 1530
MlsI	TGGCCA	1 cut(s)	1365
MluCI	AATT	7 cut(s)	192, 832, 1540, 1572, 1654, 1665, 1737
MluNI	TGGCCA	1 cut(s)	1365
Mly113I	GGCGCC	1 cut(s)	1644
MlyI	GAGTC	6 cut(s)	31, 170, 258, 518, 586, 1109
MmeI	TCCRAC	1 cut(s)	831
Mox20I	TGGCCA	1 cut(s)	1365
MroXI	GAANNNNTTC	1 cut(s)	593
MscI	TGGCCA	1 cut(s)	1365
MseI	TTAA	7 cut(s)	378, 459, 840, 945, 993, 1160, 1277
MslI	CAYNNNNRTG	7 cut(s)	173, 555, 798, 911, 1365, 1436, 1674
Msp20I	TGGCCA	1 cut(s)	1365
MspCI	CTTAAG	1 cut(s)	458
MspI	CCGG	1 cut(s)	439
MspR9I	CCNGG	1 cut(s)	1169
Mva1269I	GAATGC	2 cut(s)	1033, 1246
MvaI	CCWGG	1 cut(s)	1169
MvnI	CGCG	2 cut(s)	313, 417
MwoI	GCNNNNNNNGC	9 cut(s)	263, 461, 1037, 1046, 1352, 1376, 1464, 1643, 1690
NarI	GGCGCC	1 cut(s)	1644
NcoI	CCATGG	2 cut(s)	1204, 1462
NdeI	CATATG	1 cut(s)	1594
NdeII	GATC	1 cut(s)	351
NheI	GCTAGC	1 cut(s)	1684
NlaIV	GGNNCC	4 cut(s)	571, 1623, 1645, 1722
NsbI	TGCGCA	1 cut(s)	33
NspI	RCATGY	3 cut(s)	468, 1003, 1258
NspV	TTCGAA	1 cut(s)	668
OliI	CACNNNNGTG	1 cut(s)	1436
PagI	TCATGA	1 cut(s)	1087
PciI	ACATGT	1 cut(s)	1254
PcsI	WCGNNNNNNNCGW	1 cut(s)	755
PctI	GAATGC	2 cut(s)	1033, 1246
PdmI	GAANNNNTTC	1 cut(s)	593
PfeI	GAWTC	3 cut(s)	390, 482, 1186
PkrI	GCNGC	6 cut(s)	281, 886, 965, 979, 1357, 1460
PleI	GAGTC	6 cut(s)	31, 169, 257, 518, 585, 1108
PluTI	GGCGCC	1 cut(s)	1647
PpsI	GAGTC	6 cut(s)	31, 169, 257, 518, 585, 1108
PscI	ACATGT	1 cut(s)	1254
PshAI	GACNNNNGTC	1 cut(s)	125
Psp6I	CCWGG	1 cut(s)	1167
PspFI	CCCAGC	1 cut(s)	475
PspGI	CCWGG	1 cut(s)	1167
PspN4I	GGNNCC	4 cut(s)	571, 1623, 1645, 1722
PspPI	GGNCC	4 cut(s)	412, 570, 630, 1720
RsaI	GTAC	2 cut(s)	489, 1408
RsaNI	GTAC	2 cut(s)	488, 1407
RseI	CAYNNNNRTG	7 cut(s)	173, 555, 798, 911, 1365, 1436, 1674
SaqAI	TTAA	7 cut(s)	378, 459, 840, 945, 993, 1160, 1277
SatI	GCNGC	6 cut(s)	280, 885, 964, 978, 1356, 1459
Sau3AI	GATC	1 cut(s)	351
Sau96I	GGNCC	4 cut(s)	412, 570, 630, 1720
SchI	GAGTC	6 cut(s)	31, 170, 258, 518, 586, 1109
ScrFI	CCNGG	1 cut(s)	1169
SduI	GDGCHC	3 cut(s)	758, 1143, 1530
SfcI	CTRYAG	2 cut(s)	823, 1287
SfoI	GGCGCC	1 cut(s)	1645
SfuI	TTCGAA	1 cut(s)	668
SinI	GGWCC	4 cut(s)	412, 570, 630, 1720
SmiMI	CAYNNNNRTG	7 cut(s)	173, 555, 798, 911, 1365, 1436, 1674
SmlI	CTYRAG	2 cut(s)	372, 458
SmoI	CTYRAG	2 cut(s)	372, 458
Sse9I	AATT	7 cut(s)	192, 832, 1540, 1572, 1654, 1665, 1737
SspDI	GGCGCC	1 cut(s)	1643
SspMI	CTAG	3 cut(s)	254, 936, 1685
StyD4I	CCNGG	1 cut(s)	1167
StyI	CCWWGG	2 cut(s)	1204, 1462
TaaI	ACNGT	3 cut(s)	824, 987, 1127
TaiI	ACGT	2 cut(s)	129, 424
TaqI	TCGA	4 cut(s)	426, 597, 668, 758
TasI	AATT	7 cut(s)	192, 832, 1540, 1572, 1654, 1665, 1737
TauI	GCSGC	3 cut(s)	282, 887, 966
TfiI	GAWTC	3 cut(s)	390, 482, 1186
Tru1I	TTAA	7 cut(s)	378, 459, 840, 945, 993, 1160, 1277
Tru9I	TTAA	7 cut(s)	378, 459, 840, 945, 993, 1160, 1277
TscAI	CASTG	3 cut(s)	220, 712, 747
TseI	GCWGC	3 cut(s)	977, 1355, 1458
TspGWI	ACGGA	4 cut(s)	562, 601, 1424, 1533
TspRI	CASTG	3 cut(s)	220, 712, 747
Vha464I	CTTAAG	1 cut(s)	458
VpaK11BI	GGWCC	4 cut(s)	412, 570, 630, 1720
XapI	RAATTY	5 cut(s)	192, 832, 1654, 1665, 1737
XceI	RCATGY	3 cut(s)	468, 1003, 1258
XmnI	GAANNNNTTC	1 cut(s)	593
XspI	CTAG	3 cut(s)	254, 936, 1685

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.