Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8371303.1

Orthogroup ID

OG0020734

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 959

Gene Structure 959 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8371303.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 167 bp

atggatctaacaccaaagttagctgcagcggcgttcgagggagatggtggaggatatgacatatggtcatttccggcccttggcgaggccaaagttggttccaggaagcttcttttgaagcctagtggctttgctcttcctcactatgcagattctgccaaactggg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cupin_1

Protein Analysis

56

Amino Acids

5.81

Weight (kDa)

6.52

Isoelectric Point (pI)

36.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020734)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8150954.1_g000001 Rmu_co8371303.1_g000001 Rmu_sc0001971.1_g000002 Rmu_sc0004960.1_g000007
rosa_samantha	Rh7CG363800 Rh7DG344300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	29
AclWI	GGATC	1 cut(s)	12
AfiI	CCNNNNNNNGG	2 cut(s)	80, 85
AgsI	TTSAA	1 cut(s)	118
AhdI	GACNNNNNGTC	1 cut(s)	64
AjnI	CCWGG	1 cut(s)	101
AluBI	AGCT	2 cut(s)	23, 109
AluI	AGCT	2 cut(s)	23, 109
AlwI	GGATC	1 cut(s)	12
AlwNI	CAGNNNCTG	1 cut(s)	155
AoxI	GGCC	2 cut(s)	75, 87
ApeKI	GCWGC	2 cut(s)	23, 26
AspS9I	GGNCC	1 cut(s)	76
BbvI	GCAGC	2 cut(s)	10, 38
BccI	CCATC	1 cut(s)	38
BciT130I	CCWGG	1 cut(s)	103
BfaI	CTAG	1 cut(s)	123
BfmI	CTRYAG	1 cut(s)	24
BisI	GCNGC	3 cut(s)	24, 27, 30
BlsI	GCNGC	3 cut(s)	25, 28, 31
Bme1390I	CCNGG	1 cut(s)	103
BmeRI	GACNNNNNGTC	1 cut(s)	64
BmgT120I	GGNCC	1 cut(s)	76
BmiI	GGNNCC	1 cut(s)	100
BmrFI	CCNGG	1 cut(s)	103
BsaJI	CCNNGG	1 cut(s)	79
Bsc4I	CCNNNNNNNGG	2 cut(s)	80, 85
BseBI	CCWGG	1 cut(s)	103
BseDI	CCNNGG	1 cut(s)	79
BseLI	CCNNNNNNNGG	2 cut(s)	80, 85
BseXI	GCAGC	2 cut(s)	10, 38
BshFI	GGCC	2 cut(s)	77, 89
BsiSI	CCGG	1 cut(s)	74
BslI	CCNNNNNNNGG	2 cut(s)	80, 85
BsnI	GGCC	2 cut(s)	77, 89
Bsp143I	GATC	1 cut(s)	4
BspACI	CCGC	1 cut(s)	29
BspANI	GGCC	2 cut(s)	77, 89
BspLI	GGNNCC	1 cut(s)	100
BspMAI	CTGCAG	1 cut(s)	28
BspPI	GGATC	1 cut(s)	12
BspQI	GCTCTTC	1 cut(s)	141
BssECI	CCNNGG	1 cut(s)	79
BssMI	GATC	1 cut(s)	4
BssT1I	CCWWGG	1 cut(s)	79
Bst2UI	CCWGG	1 cut(s)	103
Bst6I	CTCTTC	1 cut(s)	141
BstAPI	GCANNNNNTGC	1 cut(s)	155
BstENI	CCTNNNNNAGG	1 cut(s)	83
BstKTI	GATC	1 cut(s)	7
BstMBI	GATC	1 cut(s)	4
BstMWI	GCNNNNNNNGC	2 cut(s)	29, 155
BstNI	CCWGG	1 cut(s)	103
BstSCI	CCNGG	1 cut(s)	101
BstSFI	CTRYAG	1 cut(s)	24
BstV1I	GCAGC	2 cut(s)	10, 38
BstX2I	RGATCY	1 cut(s)	4
BstYI	RGATCY	1 cut(s)	4
BsuRI	GGCC	2 cut(s)	77, 89
CaiI	CAGNNNCTG	1 cut(s)	155
Cfr13I	GGNCC	1 cut(s)	76
CviJI	RGCY	6 cut(s)	23, 77, 89, 109, 121, 129
CviKI_1	RGCY	6 cut(s)	23, 77, 89, 109, 121, 129
DpnI	GATC	1 cut(s)	6
DpnII	GATC	1 cut(s)	4
DriI	GACNNNNNGTC	1 cut(s)	64
Eam1104I	CTCTTC	1 cut(s)	141
Eam1105I	GACNNNNNGTC	1 cut(s)	64
EarI	CTCTTC	1 cut(s)	141
Eco130I	CCWWGG	1 cut(s)	79
EcoNI	CCTNNNNNAGG	1 cut(s)	83
EcoRII	CCWGG	1 cut(s)	101
EcoT14I	CCWWGG	1 cut(s)	79
ErhI	CCWWGG	1 cut(s)	79
FaiI	YATR	4 cut(s)	57, 62, 64, 147
FauNDI	CATATG	1 cut(s)	62
Fnu4HI	GCNGC	3 cut(s)	24, 27, 30
Fsp4HI	GCNGC	3 cut(s)	24, 27, 30
FspBI	CTAG	1 cut(s)	123
GluI	GCNGC	3 cut(s)	24, 27, 30
HaeIII	GGCC	2 cut(s)	77, 89
HapII	CCGG	1 cut(s)	74
HindIII	AAGCTT	1 cut(s)	107
HinfI	GANTC	1 cut(s)	152
HpaII	CCGG	1 cut(s)	74
HpyCH4V	TGCA	2 cut(s)	26, 149
HpyF10VI	GCNNNNNNNGC	2 cut(s)	29, 155
Kzo9I	GATC	1 cut(s)	4
LguI	GCTCTTC	1 cut(s)	141
LpnPI	CCDG	4 cut(s)	87, 88, 115, 149
Lsp1109I	GCAGC	2 cut(s)	10, 38
MaeI	CTAG	1 cut(s)	123
MalI	GATC	1 cut(s)	6
MboI	GATC	1 cut(s)	4
MboII	GAAGA	1 cut(s)	128
MflI	RGATCY	1 cut(s)	4
MnlI	CCTC	4 cut(s)	31, 44, 79, 150
MspA1I	CMGCKG	1 cut(s)	29
MspI	CCGG	1 cut(s)	74
MspR9I	CCNGG	1 cut(s)	103
MvaI	CCWGG	1 cut(s)	103
MwoI	GCNNNNNNNGC	2 cut(s)	29, 155
NdeI	CATATG	1 cut(s)	62
NdeII	GATC	1 cut(s)	4
NlaIV	GGNNCC	1 cut(s)	100
PciSI	GCTCTTC	1 cut(s)	141
PfeI	GAWTC	1 cut(s)	152
PfoI	TCCNGGA	1 cut(s)	101
PkrI	GCNGC	3 cut(s)	25, 28, 31
Psp6I	CCWGG	1 cut(s)	101
PspGI	CCWGG	1 cut(s)	101
PspN4I	GGNNCC	1 cut(s)	100
PspPI	GGNCC	1 cut(s)	76
PstI	CTGCAG	1 cut(s)	28
PstNI	CAGNNNCTG	1 cut(s)	155
PsuI	RGATCY	1 cut(s)	4
SapI	GCTCTTC	1 cut(s)	141
SatI	GCNGC	3 cut(s)	24, 27, 30
Sau3AI	GATC	1 cut(s)	4
Sau96I	GGNCC	1 cut(s)	76
ScrFI	CCNGG	1 cut(s)	103
SetI	ASST	2 cut(s)	25, 111
SfcI	CTRYAG	1 cut(s)	24
SgeI	CNNG	7 cut(s)	49, 86, 92, 97, 114, 115, 135
SsiI	CCGC	1 cut(s)	29
SspMI	CTAG	1 cut(s)	123
StyD4I	CCNGG	1 cut(s)	101
StyI	CCWWGG	1 cut(s)	79
TaqI	TCGA	1 cut(s)	36
TauI	GCSGC	1 cut(s)	32
TfiI	GAWTC	1 cut(s)	152
TseI	GCWGC	2 cut(s)	23, 26
XagI	CCTNNNNNAGG	1 cut(s)	83
XspI	CTAG	1 cut(s)	123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.