Rmu_sc0001971.1_g000002

11S globulin seed storage protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001971.1
OG0020734
Physical Location & Seq
Forward (+)
4433 .. 4918
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001971.1_g000002.1.cds

Sequence Viewer

Length: 300 bp
atggatctaacaccaaagttagctgcagcggcgttcgagggagatggtggaggatatgacatatggtcatttccggcccttggcgaggccaaagttggttccaggaagcttcttttgaagcctagtggctttgctcttcctcactatgcagattctgccaaactgggtgtttttgatttatccggtatcgtcaactccatccaaattttctgtttaaaccctagtgtttgtgtttggcacgttaatgcatttttgataatttccaacccaaatactaacatggttcttgatactgtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cupin_1

Protein Analysis

99

Amino Acids

10.54

Weight (kDa)

5.42

Isoelectric Point (pI)

25.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020734)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8150954.1_g000001 Rmu_co8371303.1_g000001 Rmu_sc0001971.1_g000002 Rmu_sc0004960.1_g000007
rosa_samantha Rh7CG363800 Rh7DG344300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 204
AfiI CCNNNNNNNGG 2 cut(s) 80, 85
AgsI TTSAA 1 cut(s) 118
AhdI GACNNNNNGTC 1 cut(s) 64
AjnI CCWGG 1 cut(s) 101
AluBI AGCT 2 cut(s) 23, 109
AluI AGCT 2 cut(s) 23, 109
AlwI GGATC 1 cut(s) 12
AlwNI CAGNNNCTG 1 cut(s) 155
AoxI GGCC 2 cut(s) 75, 87
ApeKI GCWGC 2 cut(s) 23, 26
ApoI RAATTY 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 76
BbvI GCAGC 2 cut(s) 10, 38
BccI CCATC 2 cut(s) 38, 206
BciT130I CCWGG 1 cut(s) 103
BfaI CTAG 2 cut(s) 123, 222
BfmI CTRYAG 1 cut(s) 24
BisI GCNGC 3 cut(s) 24, 27, 30
BlsI GCNGC 3 cut(s) 25, 28, 31
Bme1390I CCNGG 1 cut(s) 103
BmeRI GACNNNNNGTC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 76
BmiI GGNNCC 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 103
BmrI ACTGGG 1 cut(s) 173
BmuI ACTGGG 1 cut(s) 173
BsaJI CCNNGG 1 cut(s) 79
BsaWI WCCGGW 1 cut(s) 182
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 85
Bse1I ACTGG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 103
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 1 cut(s) 198
BseLI CCNNNNNNNGG 2 cut(s) 80, 85
BseNI ACTGG 1 cut(s) 168
BseXI GCAGC 2 cut(s) 10, 38
BshFI GGCC 2 cut(s) 77, 89
BsiSI CCGG 2 cut(s) 74, 183
BslI CCNNNNNNNGG 2 cut(s) 80, 85
BsnI GGCC 2 cut(s) 77, 89
Bsp143I GATC 1 cut(s) 4
BspACI CCGC 1 cut(s) 29
BspANI GGCC 2 cut(s) 77, 89
BspLI GGNNCC 1 cut(s) 100
BspMAI CTGCAG 1 cut(s) 28
BspPI GGATC 1 cut(s) 12
BspQI GCTCTTC 1 cut(s) 141
BsrI ACTGG 1 cut(s) 168
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 4
BssT1I CCWWGG 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 295
Bst6I CTCTTC 1 cut(s) 141
BstAPI GCANNNNNTGC 1 cut(s) 155
BstENI CCTNNNNNAGG 1 cut(s) 83
BstF5I GGATG 1 cut(s) 198
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 2 cut(s) 29, 155
BstNI CCWGG 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 101
BstSFI CTRYAG 1 cut(s) 24
BstV1I GCAGC 2 cut(s) 10, 38
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 2 cut(s) 77, 89
BtsCI GGATG 1 cut(s) 198
CaiI CAGNNNCTG 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 76
CviAII CATG 1 cut(s) 280
CviJI RGCY 6 cut(s) 23, 77, 89, 109, 121, 129
CviKI_1 RGCY 6 cut(s) 23, 77, 89, 109, 121, 129
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
DraI TTTAAA 1 cut(s) 216
DriI GACNNNNNGTC 1 cut(s) 64
Eam1104I CTCTTC 1 cut(s) 141
Eam1105I GACNNNNNGTC 1 cut(s) 64
EarI CTCTTC 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 79
EcoNI CCTNNNNNAGG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 101
EcoT14I CCWWGG 1 cut(s) 79
EcoT22I ATGCAT 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 283
FaiI YATR 6 cut(s) 57, 62, 64, 147, 281, 298
FatI CATG 1 cut(s) 279
FauNDI CATATG 1 cut(s) 62
Fnu4HI GCNGC 3 cut(s) 24, 27, 30
FokI GGATG 1 cut(s) 185
Fsp4HI GCNGC 3 cut(s) 24, 27, 30
FspBI CTAG 2 cut(s) 123, 222
GluI GCNGC 3 cut(s) 24, 27, 30
HaeIII GGCC 2 cut(s) 77, 89
HapII CCGG 2 cut(s) 74, 183
Hin1II CATG 1 cut(s) 283
HincII GTYRAC 1 cut(s) 193
HindII GTYRAC 1 cut(s) 193
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 1 cut(s) 152
HpaII CCGG 2 cut(s) 74, 183
Hpy166II GTNNAC 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 287
Hpy8I GTNNAC 1 cut(s) 193
HpyCH4III ACNGT 1 cut(s) 295
HpyCH4IV ACGT 1 cut(s) 240
HpyCH4V TGCA 3 cut(s) 26, 149, 248
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 155
HpySE526I ACGT 1 cut(s) 240
Hsp92II CATG 1 cut(s) 283
Kzo9I GATC 1 cut(s) 4
LguI GCTCTTC 1 cut(s) 141
LpnPI CCDG 5 cut(s) 87, 88, 115, 149, 196
Lsp1109I GCAGC 2 cut(s) 10, 38
MaeI CTAG 2 cut(s) 123, 222
MaeII ACGT 1 cut(s) 240
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MboII GAAGA 1 cut(s) 128
MflI RGATCY 1 cut(s) 4
MluCI AATT 2 cut(s) 204, 258
MmeI TCCRAC 1 cut(s) 288
MnlI CCTC 4 cut(s) 31, 44, 79, 150
Mph1103I ATGCAT 1 cut(s) 250
MseI TTAA 2 cut(s) 215, 243
MslI CAYNNNNRTG 1 cut(s) 243
MspA1I CMGCKG 1 cut(s) 29
MspI CCGG 2 cut(s) 74, 183
MspR9I CCNGG 1 cut(s) 103
MssI GTTTAAAC 1 cut(s) 216
MvaI CCWGG 1 cut(s) 103
MwoI GCNNNNNNNGC 2 cut(s) 29, 155
NdeI CATATG 1 cut(s) 62
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 283
NlaIV GGNNCC 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 250
PciSI GCTCTTC 1 cut(s) 141
PfeI GAWTC 1 cut(s) 152
PfoI TCCNGGA 1 cut(s) 101
PkrI GCNGC 3 cut(s) 25, 28, 31
PmeI GTTTAAAC 1 cut(s) 216
Psp6I CCWGG 1 cut(s) 101
PspGI CCWGG 1 cut(s) 101
PspN4I GGNNCC 1 cut(s) 100
PspPI GGNCC 1 cut(s) 76
PstI CTGCAG 1 cut(s) 28
PstNI CAGNNNCTG 1 cut(s) 155
PsuI RGATCY 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 243
SapI GCTCTTC 1 cut(s) 141
SaqAI TTAA 2 cut(s) 215, 243
SatI GCNGC 3 cut(s) 24, 27, 30
Sau3AI GATC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 76
ScrFI CCNGG 1 cut(s) 103
SetI ASST 3 cut(s) 25, 111, 243
SfcI CTRYAG 1 cut(s) 24
SmiMI CAYNNNNRTG 1 cut(s) 243
Sse9I AATT 2 cut(s) 204, 258
SsiI CCGC 1 cut(s) 29
SspMI CTAG 2 cut(s) 123, 222
StyD4I CCNGG 1 cut(s) 101
StyI CCWWGG 1 cut(s) 79
TaaI ACNGT 1 cut(s) 295
TaiI ACGT 1 cut(s) 243
TaqI TCGA 1 cut(s) 36
TasI AATT 2 cut(s) 204, 258
TauI GCSGC 1 cut(s) 32
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 2 cut(s) 215, 243
Tru9I TTAA 2 cut(s) 215, 243
TseI GCWGC 2 cut(s) 23, 26
XagI CCTNNNNNAGG 1 cut(s) 83
XapI RAATTY 1 cut(s) 204
XspI CTAG 2 cut(s) 123, 222
Zsp2I ATGCAT 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.