Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8487175.1

Orthogroup ID

OG0013352

Physical Location & Seq

Genomic Coordinates Forward (+)

4 .. 1302

Gene Structure 1299 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8487175.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1299 bp

atgtgtgtgaaatatggggagttgggtttggcggattttttgttcggaactatggtcgagagagatttagttgcttggaatgcttttgttgctgcttgtgtgcagagtggacatgctgcaaaggctcttcatttgtttcgccggatgcgtgtggctggagtggagcctgatgctgttacggttgtgagtgctttttcggcttgtggtcagttagggtgtttggagactggggaagagattgatggggttatgagacaatgtgggattgtttgcaatgtaattgttgacaatgcgcggcttgatatgtatgtcaaatgcggtagcgtggacatggctgaggctttgtttgaggatatgcatcagagaaatgttatttcctggagcactatggtattagggtatgcaataaatggggagagccgcaaggcattggatatgttttcgtggatgcaaaagcgaggagttgctcccaaccatgtcacgtatctaggagttttatccgcatgcagccatgctggactggtgaatgaaggcaaatctcattttaggcgcatggtgcaagctggtgacaagaatattcaaccgaaaatagagcactatgcttgcatggttgatctccttggtcggtcaggacatcttgaggaggcttataacttcataagaagtatgccaattgaactcgataccggggtgtggggagctttattgggtgcgtgtgcaatccaccaaaacgttgaactgggtcagcatgtagctgatttgctttttgaattagctcctgctaatggttcatatcatgtcttgatgtcaaacatgtatgcggctgctggaagatgggactgtgttgacaaggtgaggctcaaaatgcgaaaaggaggtgttaagaaagtagctgcctatagctcagtagagtttaatggaaaaatccatatattttatggtggtaacagattgcatccagaatcatcagaaatatatgaaaaattggaggatttattaagacaagtgaagaatataggttacactccaaatatcacctctgtgtttcatgatgtgggcacagaggaaaaggaagccacactcagtcatcacagtgaaaagcttgccattgcatttagtcttctaaatctacagcctgaatgccccattagagtggtgaagaatttacgaatctgtgatgactgccacagtttctgtaaatttgtctccgaagcgaccaaaagggtgattatcatgagagataaaatccgttttcatcattttagaaatggtgagtgttcttgcaacaacttttggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

432

Amino Acids

48.19

Weight (kDa)

6.82

Isoelectric Point (pI)

46.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013352)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G01510 AT2G01510
fragaria_vesca	FvH4_4g32680
malus_domestica	MD13G1023400.v1.1
prunus_persica	Prupe.1G327100_v2.0.a1 Prupe.1G327100_v2.0.a1 Prupe.1G327100_v2.0.a1 Prupe.1G327100_v2.0.a1 Prupe.1G327100_v2.0.a1 Prupe.1G327100_v2.0.a1
pyrus_communis	pycom13g02200
rosa_chinensis	RchiOBHm_Chr4g0441601
rosa_laevigata	RLG00000006082
rosa_multiflora	Rmu_co8487175.1_g000001 Rmu_sc0000353.1_g000025
rosa_rugosa	Rorug04G0335000
rosa_samantha	Rh4BG400500
rosa_wichuraiana	Rw4G033370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	651
AccII	CGCG	1 cut(s)	295
AciI	CCGC	6 cut(s)	32, 295, 318, 421, 501, 821
AclI	AACGTT	1 cut(s)	732
AcsI	RAATTY	2 cut(s)	1162, 1199
AfiI	CCNNNNNNNGG	2 cut(s)	693, 785
AflIII	ACRYGT	1 cut(s)	813
AgsI	TTSAA	4 cut(s)	581, 677, 737, 770
AjnI	CCWGG	1 cut(s)	377
AleI	CACNNNNGTG	1 cut(s)	1040
AloI	GAACNNNNNNTCC	2 cut(s)	26, 58
AluBI	AGCT	7 cut(s)	563, 701, 755, 776, 893, 903, 1102
AluI	AGCT	7 cut(s)	563, 701, 755, 776, 893, 903, 1102
Alw21I	GWGCWC	2 cut(s)	386, 597
Alw26I	GTCTC	3 cut(s)	218, 247, 1210
AlwNI	CAGNNNCTG	1 cut(s)	1194
ApeKI	GCWGC	5 cut(s)	92, 116, 507, 824, 893
ApoI	RAATTY	2 cut(s)	1162, 1199
AspLEI	GCGC	2 cut(s)	295, 552
AsuC2I	CCSGG	1 cut(s)	688
AsuHPI	GGTGA	7 cut(s)	535, 578, 865, 1027, 1168, 1237, 1283
BaeGI	GKGCMC	1 cut(s)	1061
BaeI	ACNNNNGTAYC	2 cut(s)	675, 708
BbsI	GAAGAC	1 cut(s)	1112
Bbv12I	GWGCWC	2 cut(s)	386, 597
BbvCI	CCTCAGC	1 cut(s)	336
BbvI	GCAGC	5 cut(s)	79, 103, 519, 811, 880
BccI	CCATC	2 cut(s)	236, 828
BciT130I	CCWGG	1 cut(s)	379
BcnI	CCSGG	1 cut(s)	688
BcoDI	GTCTC	3 cut(s)	218, 247, 1210
BfaI	CTAG	1 cut(s)	488
BfmI	CTRYAG	2 cut(s)	898, 1130
BisI	GCNGC	8 cut(s)	93, 117, 296, 421, 508, 822, 825, 894
BlsI	GCNGC	8 cut(s)	94, 118, 297, 422, 509, 823, 826, 895
Bme1390I	CCNGG	2 cut(s)	379, 688
BmiI	GGNNCC	1 cut(s)	165
BmrFI	CCNGG	2 cut(s)	379, 688
BmrI	ACTGGG	2 cut(s)	237, 749
BmsI	GCATC	5 cut(s)	135, 160, 367, 438, 964
BmuI	ACTGGG	2 cut(s)	237, 749
BpiI	GAAGAC	1 cut(s)	1112
BpmI	CTGGAG	2 cut(s)	177, 400
Bpu10I	CCTNAGC	1 cut(s)	336
BpuEI	CTTGAG	1 cut(s)	659
BpuMI	CCSGG	1 cut(s)	688
BsaAI	YACGTR	1 cut(s)	483
BsaBI	GATNNNNATC	1 cut(s)	357
BsaJI	CCNNGG	2 cut(s)	619, 687
Bsc4I	CCNNNNNNNGG	2 cut(s)	693, 785
Bse1I	ACTGG	3 cut(s)	232, 525, 744
Bse3DI	GCAATG	2 cut(s)	280, 1107
Bse8I	GATNNNNATC	1 cut(s)	357
BseBI	CCWGG	1 cut(s)	379
BseDI	CCNNGG	2 cut(s)	619, 687
BseGI	GGATG	3 cut(s)	150, 453, 955
BseJI	GATNNNNATC	1 cut(s)	357
BseLI	CCNNNNNNNGG	2 cut(s)	693, 785
BseMI	GCAATG	2 cut(s)	280, 1107
BseMII	CTCAG	3 cut(s)	327, 918, 1096
BseNI	ACTGG	3 cut(s)	232, 525, 744
BseRI	GAGGAG	2 cut(s)	474, 656
BseSI	GKGCMC	1 cut(s)	1061
BseXI	GCAGC	5 cut(s)	79, 103, 519, 811, 880
BsgI	GTGCAG	1 cut(s)	122
Bsh1236I	CGCG	1 cut(s)	295
BsiHKAI	GWGCWC	2 cut(s)	386, 597
BsiSI	CCGG	2 cut(s)	142, 687
BslFI	GGGAC	1 cut(s)	851
BslI	CCNNNNNNNGG	2 cut(s)	693, 785
BsmAI	GTCTC	3 cut(s)	218, 247, 1210
BsmFI	GGGAC	1 cut(s)	851
BsmI	GAATGC	2 cut(s)	85, 1145
Bsp1286I	GDGCHC	3 cut(s)	386, 597, 1061
Bsp143I	GATC	1 cut(s)	613
BspACI	CCGC	6 cut(s)	32, 295, 318, 421, 501, 821
BspCNI	CTCAG	3 cut(s)	328, 917, 1095
BspFNI	CGCG	1 cut(s)	295
BspHI	TCATGA	2 cut(s)	1048, 1233
BspLI	GGNNCC	1 cut(s)	165
BspQI	GCTCTTC	1 cut(s)	132
BsrDI	GCAATG	2 cut(s)	280, 1107
BsrI	ACTGG	3 cut(s)	232, 525, 744
BssECI	CCNNGG	2 cut(s)	619, 687
BssMI	GATC	1 cut(s)	613
BssT1I	CCWWGG	1 cut(s)	619
Bst2UI	CCWGG	1 cut(s)	379
Bst4CI	ACNGT	4 cut(s)	181, 842, 1094, 1190
Bst6I	CTCTTC	2 cut(s)	132, 228
BstBAI	YACGTR	1 cut(s)	483
BstC8I	GCNNGC	4 cut(s)	505, 561, 604, 1104
BstDEI	CTNAG	3 cut(s)	336, 904, 1082
BstF5I	GGATG	3 cut(s)	150, 453, 955
BstFNI	CGCG	1 cut(s)	295
BstHHI	GCGC	2 cut(s)	295, 552
BstKTI	GATC	1 cut(s)	616
BstMAI	GTCTC	3 cut(s)	218, 247, 1210
BstMBI	GATC	1 cut(s)	613
BstMWI	GCNNNNNNNGC	6 cut(s)	80, 89, 122, 197, 556, 865
BstNI	CCWGG	1 cut(s)	379
BstNSI	RCATGY	4 cut(s)	116, 507, 752, 817
BstSCI	CCNGG	2 cut(s)	377, 686
BstSFI	CTRYAG	2 cut(s)	898, 1130
BstSLI	GKGCMC	1 cut(s)	1061
BstUI	CGCG	1 cut(s)	295
BstV1I	GCAGC	5 cut(s)	79, 103, 519, 811, 880
BstV2I	GAAGAC	1 cut(s)	1112
BstXI	CCANNNNNNTGG	1 cut(s)	1153
BtsCI	GGATG	3 cut(s)	150, 453, 955
BtsIMutI	CAGTG	1 cut(s)	1099
Cac8I	GCNNGC	4 cut(s)	505, 561, 604, 1104
CaiI	CAGNNNCTG	1 cut(s)	1194
CciI	TCATGA	2 cut(s)	1048, 1233
CfoI	GCGC	2 cut(s)	295, 552
DdeI	CTNAG	3 cut(s)	336, 904, 1082
DpnI	GATC	1 cut(s)	615
DpnII	GATC	1 cut(s)	613
Eam1104I	CTCTTC	2 cut(s)	132, 228
EarI	CTCTTC	2 cut(s)	132, 228
EciI	GGCGGA	1 cut(s)	47
Eco130I	CCWWGG	1 cut(s)	619
EcoRII	CCWGG	1 cut(s)	377
EcoT14I	CCWWGG	1 cut(s)	619
EcoT22I	ATGCAT	1 cut(s)	360
ErhI	CCWWGG	1 cut(s)	619
FaqI	GGGAC	1 cut(s)	851
Fnu4HI	GCNGC	8 cut(s)	93, 117, 296, 421, 508, 822, 825, 894
FokI	GGATG	3 cut(s)	157, 460, 942
Fsp4HI	GCNGC	8 cut(s)	93, 117, 296, 421, 508, 822, 825, 894
FspBI	CTAG	1 cut(s)	488
GlaI	GCGC	2 cut(s)	294, 551
GluI	GCNGC	8 cut(s)	93, 117, 296, 421, 508, 822, 825, 894
GsuI	CTGGAG	2 cut(s)	177, 400
HapII	CCGG	2 cut(s)	142, 687
HhaI	GCGC	2 cut(s)	295, 552
Hin6I	GCGC	2 cut(s)	293, 550
HinP1I	GCGC	2 cut(s)	293, 550
HincII	GTYRAC	2 cut(s)	286, 847
HindII	GTYRAC	2 cut(s)	286, 847
HindIII	AAGCTT	1 cut(s)	1100
HinfI	GANTC	2 cut(s)	962, 1170
HpaII	CCGG	2 cut(s)	142, 687
HphI	GGTGA	7 cut(s)	535, 578, 865, 1027, 1168, 1237, 1283
Hpy166II	GTNNAC	4 cut(s)	110, 286, 328, 847
Hpy188I	TCNGA	4 cut(s)	47, 363, 970, 1210
Hpy188III	TCNNGA	7 cut(s)	58, 630, 638, 802, 959, 1049, 1234
Hpy8I	GTNNAC	4 cut(s)	110, 286, 328, 847
HpyAV	CCTTC	1 cut(s)	524
HpyCH4III	ACNGT	4 cut(s)	181, 842, 1094, 1190
HpyCH4IV	ACGT	2 cut(s)	482, 732
HpyF10VI	GCNNNNNNNGC	6 cut(s)	80, 89, 122, 197, 556, 865
HpyF3I	CTNAG	3 cut(s)	336, 904, 1082
HpySE526I	ACGT	2 cut(s)	482, 732
HspAI	GCGC	2 cut(s)	293, 550
Kzo9I	GATC	1 cut(s)	613
LguI	GCTCTTC	1 cut(s)	132
LmnI	GCTCC	5 cut(s)	163, 381, 472, 698, 781
Lsp1109I	GCAGC	5 cut(s)	79, 103, 519, 811, 880
LweI	GCATC	5 cut(s)	135, 160, 367, 438, 964
MaeI	CTAG	1 cut(s)	488
MaeII	ACGT	2 cut(s)	482, 732
MaeIII	GTNAC	5 cut(s)	175, 478, 566, 944, 1019
MalI	GATC	1 cut(s)	615
MboI	GATC	1 cut(s)	613
MboII	GAAGA	6 cut(s)	119, 245, 843, 1021, 1112, 1171
MfeI	CAATTG	1 cut(s)	672
MhlI	GDGCHC	3 cut(s)	386, 597, 1061
MluCI	AATT	6 cut(s)	279, 672, 770, 983, 1162, 1199
Mph1103I	ATGCAT	1 cut(s)	360
MseI	TTAA	3 cut(s)	882, 915, 998
MslI	CAYNNNNRTG	3 cut(s)	1040, 1092, 1151
MspI	CCGG	2 cut(s)	142, 687
MspR9I	CCNGG	2 cut(s)	379, 688
MunI	CAATTG	1 cut(s)	672
Mva1269I	GAATGC	2 cut(s)	85, 1145
MvaI	CCWGG	1 cut(s)	379
MvnI	CGCG	1 cut(s)	295
MwoI	GCNNNNNNNGC	6 cut(s)	80, 89, 122, 197, 556, 865
NciI	CCSGG	1 cut(s)	688
NdeII	GATC	1 cut(s)	613
NlaIV	GGNNCC	1 cut(s)	165
NmuCI	GTSAC	2 cut(s)	478, 566
NsiI	ATGCAT	1 cut(s)	360
NspI	RCATGY	4 cut(s)	116, 507, 752, 817
OliI	CACNNNNGTG	1 cut(s)	1040
PaeI	GCATGC	1 cut(s)	507
PagI	TCATGA	2 cut(s)	1048, 1233
PciI	ACATGT	1 cut(s)	813
PciSI	GCTCTTC	1 cut(s)	132
PcsI	WCGNNNNNNNCGW	1 cut(s)	145
PctI	GAATGC	2 cut(s)	85, 1145
PfeI	GAWTC	2 cut(s)	962, 1170
PfoI	TCCNGGA	1 cut(s)	377
PkrI	GCNGC	8 cut(s)	94, 118, 297, 422, 509, 823, 826, 895
Ppu21I	YACGTR	1 cut(s)	483
PscI	ACATGT	1 cut(s)	813
PsiI	TTATAA	1 cut(s)	651
Psp1406I	AACGTT	1 cut(s)	732
Psp6I	CCWGG	1 cut(s)	377
PspGI	CCWGG	1 cut(s)	377
PspN4I	GGNNCC	1 cut(s)	165
PstNI	CAGNNNCTG	1 cut(s)	1194
RseI	CAYNNNNRTG	3 cut(s)	1040, 1092, 1151
SapI	GCTCTTC	1 cut(s)	132
SaqAI	TTAA	3 cut(s)	882, 915, 998
SatI	GCNGC	8 cut(s)	93, 117, 296, 421, 508, 822, 825, 894
Sau3AI	GATC	1 cut(s)	613
ScrFI	CCNGG	2 cut(s)	379, 688
SduI	GDGCHC	3 cut(s)	386, 597, 1061
SfaNI	GCATC	5 cut(s)	135, 160, 367, 438, 964
SfcI	CTRYAG	2 cut(s)	898, 1130
SmiMI	CAYNNNNRTG	3 cut(s)	1040, 1092, 1151
SmlI	CTYRAG	1 cut(s)	638
SmoI	CTYRAG	1 cut(s)	638
SphI	GCATGC	1 cut(s)	507
Sse9I	AATT	6 cut(s)	279, 672, 770, 983, 1162, 1199
SsiI	CCGC	6 cut(s)	32, 295, 318, 421, 501, 821
SspI	AATATT	1 cut(s)	577
SspMI	CTAG	1 cut(s)	488
StyD4I	CCNGG	2 cut(s)	377, 686
StyI	CCWWGG	1 cut(s)	619
TaaI	ACNGT	4 cut(s)	181, 842, 1094, 1190
TaiI	ACGT	2 cut(s)	485, 735
TaqI	TCGA	2 cut(s)	57, 681
TaqII	GACCGA	1 cut(s)	615
TasI	AATT	6 cut(s)	279, 672, 770, 983, 1162, 1199
TauI	GCSGC	3 cut(s)	298, 423, 824
TfiI	GAWTC	2 cut(s)	962, 1170
Tru1I	TTAA	3 cut(s)	882, 915, 998
Tru9I	TTAA	3 cut(s)	882, 915, 998
TscAI	CASTG	1 cut(s)	1099
TseFI	GTSAC	2 cut(s)	478, 566
TseI	GCWGC	5 cut(s)	92, 116, 507, 824, 893
Tsp45I	GTSAC	2 cut(s)	478, 566
TspDTI	ATGAA	7 cut(s)	119, 543, 646, 780, 993, 1037, 1244
TspGWI	ACGGA	1 cut(s)	1238
TspRI	CASTG	1 cut(s)	1099
XapI	RAATTY	2 cut(s)	1162, 1199
XceI	RCATGY	4 cut(s)	116, 507, 752, 817
XcmI	CCANNNNNNNNNTGG	1 cut(s)	935
XspI	CTAG	1 cut(s)	488
Zsp2I	ATGCAT	1 cut(s)	360

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.