Rmu_co8492063.1_g000001

cystathionine gamma-lyase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8492063.1
Physical Location & Seq
Reverse (-)
628 .. 2280
1653 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8492063.1_g000001.1.cds

Sequence Viewer

Length: 1551 bp
atgggaggacctttcaatcacaacaagggtgggaatagtagtaattctaatagcaacagagggaggtcttatgggttgatgctggtgttggtatttggggctgcattggttggagtcatggtgctccataagctcagagaaaggcgcatcttcaaccttgtgatcaaagagaaagacactgagctcgtttcgcttcacctcgccttacagaaggagagagactacagtcgggaagtgaaaatgaagcatgaagatctgaaagcgaagatgtattccattcgaacacaaaagatgaggcttgagaggacagtggtggagatgaagtctactattggttcgcttaaagaggagctgagaacaatggaggctgcatttgaggagaagcaaaacgaaaccaaaatgccgttgagaggaaatggtgatcagagtgataatcctcgggtgatgaagttggtggaaagcttgaagcaaaaggaagctgaaatcgaggatttgaaacaccgccttgagtataaggtgtggtcggtaagtactgacgacccatcaaacccaaccagaaatctaaccatgtccagaaggagagacgaggctgatcaagtgtcaagtgaagatggaaatggcaataaatccatgaatttcaaacagggtgagactacgaaagaagtagaaggtcaagttggaaaagcagagggggaaacatataggatggaaatgatggcgaaaaagtcagagaagatgggtaattcccaagaggtgaatttgaaaggtggcaatggaggtggaaataccactgatgagggccaagcaaagaagagtcgggatttcaaagatgttgatcataaagcaattgatggtcaagagattaagggaagaccaaatgggaatcttcaagaaattgaaaattctgaactaggtgatggtcagaaatttcatgtgaaaacagagcgtgggatgaagttggaaatgcaagacaagggatctgaaaataagggaaggtctagagtgggagggaagcaaggctacaatattggtatcaaaggaaagaaatggagatcagttgccaagaattggaggatggagaagaagggaaattctagaaacaatggggtggcaagcatgggaggtaggagattctttgaagatgatcggtataagggcagagcagaggaagtgtcttcgaacaggagactatcaagtaatgatcgcacgatgcaagcaagggagtcagcggattcaagtgatgcagaagatctgaaaaacaagcttacacatgttgattccaccgagggtaatggtagcgtcaatggcatagcaagtaatgctataaaacagaaacaagaatttgaaaaatcagaagaccatgaagccattagcatccaacagaatctaaacaacaaggatatcagcaacctagaagatagcattgatgttgatacccaggactttccaggagatttggaagttgcagatgcagaagaacacgagagagatgtacctgaggacggtttctttggtgaatcaggttccaatttggaagataaaagagtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

516

Amino Acids

58.08

Weight (kDa)

6.45

Isoelectric Point (pI)

43.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017349)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g44840
prunus_persica Prupe.3G232500_v2.0.a1
pyrus_communis pycom09g01800
rosa_chinensis RchiOBHm_Chr2g0162021
rosa_laevigata RLG00000021315
rosa_multiflora Rmu_co8492063.1_g000001
rosa_roxburghii Rroxscaffold_2G00088390
rosa_rugosa Rorug02G0494000
rosa_samantha Rh2AG560000 Rh2BG573400 Rh2CG543600 Rh2DG583200
rosa_wichuraiana Rw2G046350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 1068
AccI GTMKAC 1 cut(s) 326
AciI CCGC 2 cut(s) 502, 1229
AclWI GGATC 1 cut(s) 985
AcsI RAATTY 6 cut(s) 634, 757, 901, 926, 1090, 1340
AfaI GTAC 2 cut(s) 532, 1494
AfiI CCNNNNNNNGG 3 cut(s) 410, 1068, 1502
AflIII ACRYGT 1 cut(s) 1270
AjnI CCWGG 2 cut(s) 1437, 1447
AjuI GAANNNNNNNTTGG 2 cut(s) 660, 692
AluBI AGCT 6 cut(s) 133, 184, 352, 462, 479, 1264
AluI AGCT 6 cut(s) 133, 184, 352, 462, 479, 1264
Alw21I GWGCWC 2 cut(s) 126, 186
Alw26I GTCTC 4 cut(s) 213, 576, 644, 1180
AlwI GGATC 1 cut(s) 985
Ama87I CYCGRG 1 cut(s) 438
AoxI GGCC 1 cut(s) 799
ApeKI GCWGC 2 cut(s) 101, 368
ApoI RAATTY 6 cut(s) 634, 757, 901, 926, 1090, 1340
ArsI GACNNNNNNTTYG 2 cut(s) 1493, 1525
AspLEI GCGC 1 cut(s) 147
AspS9I GGNCC 2 cut(s) 8, 799
AsuHPI GGTGA 7 cut(s) 188, 431, 454, 659, 766, 926, 1526
AsuII TTCGAA 2 cut(s) 280, 1178
AvaI CYCGRG 1 cut(s) 438
AvaII GGWCC 1 cut(s) 8
AxyI CCTNAGG 1 cut(s) 1497
BanII GRGCYC 1 cut(s) 186
BarI GAAGNNNNNNTAC 2 cut(s) 1004, 1036
BauI CACGAG 1 cut(s) 1481
BbsI GAAGAC 3 cut(s) 877, 1167, 1362
Bbv12I GWGCWC 2 cut(s) 126, 186
BbvI GCAGC 2 cut(s) 88, 355
BccI CCATC 8 cut(s) 550, 605, 700, 709, 730, 845, 911, 1069
BceAI ACGGC 1 cut(s) 388
BciT130I CCWGG 2 cut(s) 1439, 1449
BclI TGATCA 4 cut(s) 162, 421, 592, 835
BcoDI GTCTC 4 cut(s) 213, 576, 644, 1180
BfaI CTAG 4 cut(s) 911, 999, 1095, 1412
BfmI CTRYAG 1 cut(s) 223
BglII AGATCT 2 cut(s) 253, 1249
BisI GCNGC 2 cut(s) 102, 369
BlsI GCNGC 2 cut(s) 103, 370
BmcAI AGTACT 1 cut(s) 532
Bme1390I CCNGG 2 cut(s) 1439, 1449
Bme18I GGWCC 1 cut(s) 8
BmeT110I CYCGRG 1 cut(s) 438
BmgT120I GGNCC 2 cut(s) 8, 799
BmiI GGNNCC 1 cut(s) 1525
BmrFI CCNGG 2 cut(s) 1439, 1449
BmsI GCATC 6 cut(s) 69, 156, 1200, 1231, 1383, 1459
BoxI GACNNNNGTC 1 cut(s) 225
BpiI GAAGAC 3 cut(s) 877, 1167, 1362
Bpu14I TTCGAA 2 cut(s) 280, 1178
BpuEI CTTGAG 2 cut(s) 320, 527
BsaBI GATNNNNATC 1 cut(s) 834
BsaJI CCNNGG 3 cut(s) 437, 1284, 1437
BsaXI ACNNNNNCTCC 4 cut(s) 105, 135, 308, 338
Bsc4I CCNNNNNNNGG 3 cut(s) 410, 1068, 1502
Bse21I CCTNAGG 1 cut(s) 1497
Bse3DI GCAATG 1 cut(s) 778
Bse8I GATNNNNATC 1 cut(s) 834
BseBI CCWGG 2 cut(s) 1439, 1449
BseDI CCNNGG 3 cut(s) 437, 1284, 1437
BseGI GGATG 4 cut(s) 711, 957, 1080, 1374
BseJI GATNNNNATC 1 cut(s) 834
BseLI CCNNNNNNNGG 3 cut(s) 410, 1068, 1502
BseMI GCAATG 1 cut(s) 778
BseMII CTCAG 4 cut(s) 148, 171, 344, 1488
BseRI GAGGAG 2 cut(s) 362, 392
BseXI GCAGC 2 cut(s) 88, 355
BshFI GGCC 1 cut(s) 801
BsiHKAI GWGCWC 2 cut(s) 126, 186
BsiHKCI CYCGRG 1 cut(s) 438
BslI CCNNNNNNNGG 3 cut(s) 410, 1068, 1502
BsmAI GTCTC 4 cut(s) 213, 576, 644, 1180
BsmBI CGTCTC 1 cut(s) 576
BsnI GGCC 1 cut(s) 801
BsoBI CYCGRG 1 cut(s) 438
Bsp119I TTCGAA 2 cut(s) 280, 1178
Bsp1286I GDGCHC 2 cut(s) 126, 186
BspACI CCGC 2 cut(s) 502, 1229
BspANI GGCC 1 cut(s) 801
BspCNI CTCAG 4 cut(s) 147, 172, 345, 1489
BspLI GGNNCC 1 cut(s) 1525
BspPI GGATC 1 cut(s) 985
BspT104I TTCGAA 2 cut(s) 280, 1178
BsrDI GCAATG 1 cut(s) 778
BssECI CCNNGG 3 cut(s) 437, 1284, 1437
BssSI CACGAG 1 cut(s) 1481
Bst2BI CACGAG 1 cut(s) 1481
Bst2UI CCWGG 2 cut(s) 1439, 1449
Bst4CI ACNGT 3 cut(s) 227, 310, 1505
Bst6I CTCTTC 1 cut(s) 806
BstAPI GCANNNNNTGC 1 cut(s) 1319
BstBI TTCGAA 2 cut(s) 280, 1178
BstC8I GCNNGC 2 cut(s) 1114, 1215
BstDEI CTNAG 4 cut(s) 134, 180, 353, 1497
BstF5I GGATG 4 cut(s) 711, 957, 1080, 1374
BstHHI GCGC 1 cut(s) 147
BstMAI GTCTC 4 cut(s) 213, 576, 644, 1180
BstMWI GCNNNNNNNGC 4 cut(s) 130, 190, 1305, 1319
BstNI CCWGG 2 cut(s) 1439, 1449
BstNSI RCATGY 1 cut(s) 1274
BstPAI GACNNNNGTC 1 cut(s) 225
BstSCI CCNGG 2 cut(s) 1437, 1447
BstSFI CTRYAG 1 cut(s) 223
BstV1I GCAGC 2 cut(s) 88, 355
BstV2I GAAGAC 3 cut(s) 877, 1167, 1362
BstX2I RGATCY 3 cut(s) 253, 977, 1249
BstYI RGATCY 3 cut(s) 253, 977, 1249
Bsu36I CCTNAGG 1 cut(s) 1497
BsuRI GGCC 1 cut(s) 801
BtsCI GGATG 4 cut(s) 711, 957, 1080, 1374
BtsIMutI CAGTG 3 cut(s) 177, 315, 789
Cac8I GCNNGC 2 cut(s) 1114, 1215
CfoI GCGC 1 cut(s) 147
Cfr13I GGNCC 2 cut(s) 8, 799
CseI GACGC 1 cut(s) 1288
Csp6I GTAC 2 cut(s) 531, 1493
CspCI CAANNNNNGTGG 4 cut(s) 10, 45, 760, 795
CviAII CATG 8 cut(s) 118, 248, 568, 631, 932, 1117, 1271, 1361
CviQI GTAC 2 cut(s) 531, 1493
DdeI CTNAG 4 cut(s) 134, 180, 353, 1497
Eam1104I CTCTTC 1 cut(s) 806
EarI CTCTTC 1 cut(s) 806
Ecl136II GAGCTC 1 cut(s) 184
Eco24I GRGCYC 1 cut(s) 186
Eco32I GATATC 1 cut(s) 1402
Eco47I GGWCC 1 cut(s) 8
Eco53kI GAGCTC 1 cut(s) 184
Eco81I CCTNAGG 1 cut(s) 1497
Eco88I CYCGRG 1 cut(s) 438
EcoICRI GAGCTC 1 cut(s) 184
EcoO109I RGGNCCY 1 cut(s) 8
EcoRII CCWGG 2 cut(s) 1437, 1447
EcoRV GATATC 1 cut(s) 1402
EcoT38I GRGCYC 1 cut(s) 186
Esp3I CGTCTC 1 cut(s) 576
FaeI CATG 8 cut(s) 121, 251, 571, 634, 935, 1120, 1274, 1364
FatI CATG 8 cut(s) 117, 247, 567, 630, 931, 1116, 1270, 1360
FbaI TGATCA 4 cut(s) 162, 421, 592, 835
FblI GTMKAC 1 cut(s) 326
Fnu4HI GCNGC 2 cut(s) 102, 369
FokI GGATG 4 cut(s) 718, 964, 1087, 1361
FriOI GRGCYC 1 cut(s) 186
Fsp4HI GCNGC 2 cut(s) 102, 369
FspBI CTAG 4 cut(s) 911, 999, 1095, 1412
GlaI GCGC 1 cut(s) 146
GluI GCNGC 2 cut(s) 102, 369
HaeIII GGCC 1 cut(s) 801
HgaI GACGC 1 cut(s) 1288
HhaI GCGC 1 cut(s) 147
Hin1II CATG 8 cut(s) 121, 251, 571, 634, 935, 1120, 1274, 1364
Hin6I GCGC 1 cut(s) 145
HinP1I GCGC 1 cut(s) 145
HindIII AAGCTT 2 cut(s) 460, 1262
HinfI GANTC 9 cut(s) 114, 814, 883, 1131, 1223, 1232, 1277, 1384, 1517
HphI GGTGA 7 cut(s) 188, 431, 454, 659, 766, 926, 1526
Hpy166II GTNNAC 1 cut(s) 327
Hpy188I TCNGA 9 cut(s) 137, 258, 426, 730, 907, 924, 982, 1254, 1354
Hpy188III TCNNGA 7 cut(s) 230, 573, 818, 857, 890, 999, 1095
Hpy8I GTNNAC 1 cut(s) 327
HpyAV CCTTC 5 cut(s) 205, 570, 662, 987, 1078
HpyCH4III ACNGT 3 cut(s) 227, 310, 1505
HpyCH4V TGCA 7 cut(s) 104, 371, 967, 1213, 1244, 1466, 1472
HpyF10VI GCNNNNNNNGC 4 cut(s) 130, 190, 1305, 1319
HpyF3I CTNAG 4 cut(s) 134, 180, 353, 1497
Hsp92II CATG 8 cut(s) 121, 251, 571, 634, 935, 1120, 1274, 1364
HspAI GCGC 1 cut(s) 145
Ksp22I TGATCA 4 cut(s) 162, 421, 592, 835
LmnI GCTCC 2 cut(s) 129, 349
Lsp1109I GCAGC 2 cut(s) 88, 355
LweI GCATC 6 cut(s) 69, 156, 1200, 1231, 1383, 1459
MaeI CTAG 4 cut(s) 911, 999, 1095, 1412
MfeI CAATTG 1 cut(s) 846
MflI RGATCY 3 cut(s) 253, 977, 1249
MhlI GDGCHC 2 cut(s) 126, 186
MlyI GAGTC 3 cut(s) 123, 823, 1232
MmeI TCCRAC 4 cut(s) 91, 658, 939, 1402
MseI TTAA 2 cut(s) 342, 864
MspA1I CMGCKG 1 cut(s) 1229
MspR9I CCNGG 2 cut(s) 1439, 1449
MunI CAATTG 1 cut(s) 846
MvaI CCWGG 2 cut(s) 1439, 1449
MwoI GCNNNNNNNGC 4 cut(s) 130, 190, 1305, 1319
NlaIII CATG 8 cut(s) 121, 251, 571, 634, 935, 1120, 1274, 1364
NlaIV GGNNCC 1 cut(s) 1525
NspI RCATGY 1 cut(s) 1274
NspV TTCGAA 2 cut(s) 280, 1178
PciI ACATGT 1 cut(s) 1270
PfeI GAWTC 6 cut(s) 883, 1131, 1232, 1277, 1384, 1517
PflMI CCANNNNNTGG 1 cut(s) 1068
PfoI TCCNGGA 1 cut(s) 1447
PkrI GCNGC 2 cut(s) 103, 370
PleI GAGTC 3 cut(s) 122, 822, 1231
PpsI GAGTC 3 cut(s) 122, 822, 1231
PpuMI RGGWCCY 1 cut(s) 8
PscI ACATGT 1 cut(s) 1270
PshAI GACNNNNGTC 1 cut(s) 225
Psp124BI GAGCTC 1 cut(s) 186
Psp5II RGGWCCY 1 cut(s) 8
Psp6I CCWGG 2 cut(s) 1437, 1447
PspGI CCWGG 2 cut(s) 1437, 1447
PspN4I GGNNCC 1 cut(s) 1525
PspPI GGNCC 2 cut(s) 8, 799
PspPPI RGGWCCY 1 cut(s) 8
PsuI RGATCY 3 cut(s) 253, 977, 1249
RsaI GTAC 2 cut(s) 532, 1494
RsaNI GTAC 2 cut(s) 531, 1493
SacI GAGCTC 1 cut(s) 186
SaqAI TTAA 2 cut(s) 342, 864
SatI GCNGC 2 cut(s) 102, 369
Sau96I GGNCC 2 cut(s) 8, 799
ScaI AGTACT 1 cut(s) 532
SchI GAGTC 3 cut(s) 123, 823, 1232
ScrFI CCNGG 2 cut(s) 1439, 1449
SduI GDGCHC 2 cut(s) 126, 186
SfaNI GCATC 6 cut(s) 69, 156, 1200, 1231, 1383, 1459
SfcI CTRYAG 1 cut(s) 223
SfuI TTCGAA 2 cut(s) 280, 1178
SinI GGWCC 1 cut(s) 8
SmlI CTYRAG 2 cut(s) 299, 506
SmoI CTYRAG 2 cut(s) 299, 506
SsiI CCGC 2 cut(s) 502, 1229
SspI AATATT 1 cut(s) 1027
SspMI CTAG 4 cut(s) 911, 999, 1095, 1412
SstI GAGCTC 1 cut(s) 186
StyD4I CCNGG 2 cut(s) 1437, 1447
TaaI ACNGT 3 cut(s) 227, 310, 1505
TaqI TCGA 3 cut(s) 280, 486, 1178
TatI WGTACW 1 cut(s) 530
TfiI GAWTC 6 cut(s) 883, 1131, 1232, 1277, 1384, 1517
Tru1I TTAA 2 cut(s) 342, 864
Tru9I TTAA 2 cut(s) 342, 864
TscAI CASTG 3 cut(s) 184, 315, 796
TseI GCWGC 2 cut(s) 101, 368
TspDTI ATGAA 8 cut(s) 257, 264, 335, 461, 647, 920, 968, 1377
TspRI CASTG 3 cut(s) 184, 315, 796
Van91I CCANNNNNTGG 1 cut(s) 1068
VpaK11BI GGWCC 1 cut(s) 8
XapI RAATTY 6 cut(s) 634, 757, 901, 926, 1090, 1340
XbaI TCTAGA 2 cut(s) 998, 1094
XceI RCATGY 1 cut(s) 1274
XmiI GTMKAC 1 cut(s) 326
XspI CTAG 4 cut(s) 911, 999, 1095, 1412
ZrmI AGTACT 1 cut(s) 532
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.