Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000007.1

Orthogroup ID

OG0005567

Physical Location & Seq

Genomic Coordinates Forward (+)

20051 .. 28016

Gene Structure 7966 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000007.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 4086 bp

atgggtttaatatgtgggaagccttctgcggttgaagatagccgggaaagcccaccaaaaagatcatctttggcttcgagtaagagacactcagggatcaaggttccgcggttgaattcttcaaaaagagaggttgttcgtactaaagatagattggatggtgctgctggtgccggtggtgctgtgaaagttatgttgattgacaaggcaatcagtggttctgtgcgattatatgatgaccagaataagagtaagaagatagaaaagcctgaggttactgttcttgatcatccgggttcaagaagaattccaaatgctactgtggctgagcaggtagccgccgggtggcctggttggctctctgcagctgcagctgaagctatcaatggctggacacctcgtcgagctgatactttccagaagttaaataaaattgggcaaggaacttatagtagcgtctacaaggcccgtgatgtcctgaatgataaatttgttgctttgaaaaaagtaagatttgataatcttgacactgagagtgtcaagtttatggcaagggaaatccttttcttgcgtaggcttgatcatcctaatgtaataaaattggaaggattgattacatcacggacatcaagcagcttgtaccttgtttttgagtatatggaacatgatcttacaggacttgcatcacgaccagggattaatttctctgaacctcaggttaagtgctacatgcagcaacttctcagtggacttgatcactgtcatagtcatggtgttttgcaccgtgacataaaggggtcaaatcttcttgttgacaacaatggaatcttgaaaattgcggactttggcttggcaagcttttatgatccacatcacagtgttgcactgacaagccgtgtgataactctctggtatcgacctccagaacttctacttggagcctctaaatatggggttgcagtggatttgtggagcactggttgcattctaggagaattatattctggaaaaccaatcctgccaggaaaaaccgaggttgaacagttgcataaaatttttaagctctgtggctcaccatctgaggattattggcgtaaattacacttgcgacattcaacagtgataagaccgccacaaccttatagaagatgtgttgcagagacttttaaggaccttcctcctgttgctctgcagcttatggaaagtttactatctgtggatcctgctgatcgaggaactgctgctattgctctcaatagtgagtactttaccaccaaacctctggcttgtgagccttcaagtttgcctaagtaccccccaagcaaagagattgatgcaaaattgagagaagaagaagctagaaggcaaggagcaagtggaggaagggcacagaaatcagacctaggaaccagaggaccaccctcagcaatttctgcgtcaaatgctaatgctgagtcaactacatcagtacagaaaagacagggatattccaatccaaatatacgaagcgaaatgttcaatcttcatagggaggaagctgtttctagtttcatgatcgatccatccaaacagttgcgaacggataaagacgctagaaaggatttctcagagaaccataataagaggacttcagtatccggaccactcatccatggacctgcatgggctaaatctgggagggaacgtggtgattctaatagaaccaacttgtcaaagttatctggtttagtattggctaggacgactgctccctctgaagatcaaaaagagaaaccaggtacttcacggcctgaaacagcaagacaagtaggcagatttcaagggtcatttgatggagaggatttcaccaaaaggcaggatcagatgcgtcacccgcagagaatcaccggtggtcatcagatagaagatgagaaagcaaatctgaatggtcgtggtcccaagggaaacaaaatatatgtctctggcccgttacttgtttcgtcaaacaatgttgatcagatgcttaaagagcatgatcgtcggatccaagaatatgctcgacgggcacgacttgacaagaataggcctgtttcatccaccaccgagtttgtcttcaacaccaacttcaactccaccagcctccttctcaatggaaacgccacaatccaatcctccatcctcagcctcacagatgaatcaacattctctatgggacgtgctttgtatgctcagaaagtccagacaaaactcgccaactcttcatctccaattcccttctcaacctccttcattttctcccttgcacctgtccaagacctccagcccggccatggttttgcctttgtgttcttgccctcttctgatttaactggtgccagctccgctcagcatttgggtttattcaacttcaccaataatggtgaccccaataacagtattcttggtattgaatttgatgtgtttaagaaccaagaatttgaggatcctaataataaccatgttggtgtggatattaactcgctcacgtctattcgttcagaggctgcagggcattggactagtagtgaggatggtgggaatttcaaggagctgaaactcaataatggggtcaattaccaagtgtggattgattttcagggttcaactattaatgtgacgatggctcatgctggtgttaaaaagcctcagaagccattgatcagtgaggtagttgatctttctagggtgcttttggatgaaatgtatgtggggtttagtggagcaaccggggcattggtacagagccataggatattggcttggagctttagtaattcgaatttttcaatcggtgacgctttggtcactcagaatttgccttcatttgtggtttctgaggcctacgtgtttggatcaaaagagttaattataagaattagtgttggtagtgttttggtcatttggtgtggggttttggggtatgtgctttttgtgaagaccaaaaggaggaaaagggatggggaaacggaggacattgaagtttgggaatcggaatattggccacaccggattgattatcaagagattcgtaaggcaacggagggattttcggagaaaaatgtgattggaaccggagggattgggaaggtctataagggggtgctggcaggagaagaagttgcaattaaaagaatttcacatgaaggtgaagatgggttgagagagttcttggctgaggtgtcaagcttaggaagactgaagcatagaaatttagtgggattgagaggttggtgcaagaaagagaaaggcagcctgattttggtttacgattacatgaaaaatgggagcttggataagaggctatttgattgcactgagacaatgatgttgagttgggaagagagaataaaggtcctgaaagatgtggcttgcgggatattgtatctgcatgaaggttgggaagctaagattttgcatagagacattaaggcaagcaatgtgctgcttgataaggatatgaatgcaaggttgggggatttcgggttggccagaatgcaccatccgggtgaactgaggggcacaacgacacaagtggttgggacggtgggctacatggcaccagaattggttcgaacaggacgagcctcagctgagattgatgtgtttggttttgggatattgatcctagaagtggtgtgtggacgaagaccgattgaagcaggacagccagggttggtcgattgggtttgtacattattggaaagaggggaaatgattcatggtcttgatgagcggttgaagagtgcaggtggatttagcattgaggaggttgagagttttcttcgtttgggtttgttgtgcgcatatcctgagcctcgtggtcgcccaacaatgaggcaagttatgaaagttctggaaggggcaactgatataagcattgatcggtctgaagggcaagaaggggaaggaattgaagtaaatttactgcaaaaaatgataacaacctcaatgtggtctacttacccactgaagctgggaggaaggggacaccctacatttgaagatatcaaacaatctttaggttcttcatcattgtttggatcagacataattcgagttggtagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004693 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0050789 GO:0050794 GO:0051726 GO:0065007 GO:0071704 GO:0071944 GO:0097472 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

1361

Amino Acids

150.56

Weight (kDa)

8.84

Isoelectric Point (pI)

41.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005567)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G03740 AT1G03740 AT5G44290 AT5G44290 AT5G44290 AT5G44290 AT5G44290 AT5G44290 AT5G44290
fragaria_vesca	FvH4_6g26290 FvH4_6g26290 FvH4_6g26290 FvH4_6g26290
malus_domestica	MD09G1246500.v1.1 MD17G1239400.v1.1
prunus_persica	Prupe.3G132000_v2.0.a1
pyrus_communis	pycom09g16390 pycom17g24290
rosa_chinensis	RchiOBHm_Chr2g0126731
rosa_laevigata	RLG00000018917
rosa_multiflora	Rmu_sc0000007.1_g000004
rosa_rugosa	Rorug02G0264300 Rorug02G0264400
rosa_samantha	Rh2AG321500 Rh2BG329600 Rh2CG309300 Rh2DG348900
rosa_wichuraiana	Rw2G026050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	2888
AarI	CACCTGC	1 cut(s)	3755
AasI	GACNNNNNNGTC	1 cut(s)	2819
Acc16I	TGCGCA	1 cut(s)	3820
Acc36I	ACCTGC	3 cut(s)	322, 1666, 3755
AccB1I	GGYRCC	3 cut(s)	170, 2351, 3574
AccBSI	CCGCTC	2 cut(s)	2363, 3751
AccI	GTMKAC	2 cut(s)	459, 3974
AccII	CGCG	1 cut(s)	109
AccIII	TCCGGA	1 cut(s)	1637
AcoI	YGGCCR	3 cut(s)	2305, 3017, 3504
AcuI	CTGAAG	6 cut(s)	396, 1614, 1776, 3236, 3927, 4007
AfaI	GTAC	8 cut(s)	142, 641, 1265, 1313, 1470, 1780, 2757, 3709
AfiI	CCNNNNNNNGG	6 cut(s)	345, 2309, 2964, 3277, 3649, 3969
AflIII	ACRYGT	1 cut(s)	2862
AgeI	ACCGGT	1 cut(s)	1886
AhdI	GACNNNNNGTC	1 cut(s)	399
AhlI	ACTAGT	1 cut(s)	2537
AjiI	CACGTC	2 cut(s)	2195, 2505
AjnI	CCWGG	5 cut(s)	349, 691, 1021, 1774, 3685
AjuI	GAANNNNNNNTTGG	4 cut(s)	918, 950, 3470, 3502
Alw21I	GWGCWC	1 cut(s)	977
Alw26I	GTCTC	5 cut(s)	79, 1154, 1963, 3329, 3432
AlwNI	CAGNNNCTG	1 cut(s)	2522
Aor13HI	TCCGGA	1 cut(s)	1637
AoxI	GGCC	9 cut(s)	347, 465, 1787, 1963, 2063, 2305, 2856, 3017, 3504
ArsI	GACNNNNNNTTYG	2 cut(s)	1941, 1973
AseI	ATTAAT	2 cut(s)	699, 2628
AsiGI	ACCGGT	1 cut(s)	1886
Asp700I	GAANNNNTTC	2 cut(s)	3585, 3732
AspA2I	CCTAGG	1 cut(s)	1402
AspLEI	GCGC	1 cut(s)	3821
AspS9I	GGNCC	8 cut(s)	466, 1171, 1415, 1640, 1655, 1934, 1964, 3370
AsuC2I	CCSGG	6 cut(s)	44, 294, 343, 2304, 2746, 3522
AsuII	TTCGAA	2 cut(s)	2795, 3589
AvaII	GGWCC	6 cut(s)	1171, 1415, 1640, 1655, 1934, 3370
AvrII	CCTAGG	1 cut(s)	1402
AxyI	CCTNAGG	2 cut(s)	270, 714
BaeGI	GKGCMC	3 cut(s)	1390, 2047, 3539
BaeI	ACNNNNGTAYC	2 cut(s)	1617, 1650
BalI	TGGCCA	2 cut(s)	3019, 3506
BamHI	GGATCC	3 cut(s)	1219, 2022, 2461
BanI	GGYRCC	3 cut(s)	170, 2351, 3574
BarI	GAAGNNNNNNTAC	2 cut(s)	3924, 3956
BauI	CACGAG	1 cut(s)	3834
BbsI	GAAGAC	4 cut(s)	2083, 2960, 3217, 3670
Bbv12I	GWGCWC	1 cut(s)	977
BbvCI	CCTCAGC	4 cut(s)	1423, 2159, 3192, 3604
BceAI	ACGGC	2 cut(s)	879, 1802
BcgI	CGANNNNNNTGC	2 cut(s)	2000, 2034
BciT130I	CCWGG	5 cut(s)	351, 693, 1023, 1776, 3687
BciVI	GTATCC	1 cut(s)	1645
BclI	TGATCA	5 cut(s)	286, 580, 754, 1993, 2676
BcnI	CCSGG	6 cut(s)	44, 294, 343, 2304, 2746, 3522
BcoDI	GTCTC	5 cut(s)	79, 1154, 1963, 3329, 3432
BcuI	ACTAGT	1 cut(s)	2537
BfaI	CTAG	9 cut(s)	989, 1359, 1403, 1545, 1593, 1737, 2538, 2700, 3644
BfmI	CTRYAG	4 cut(s)	363, 369, 1190, 2523
BfuAI	ACCTGC	3 cut(s)	322, 1666, 3755
BfuI	GTATCC	1 cut(s)	1645
BglI	GCCNNNNNGGC	1 cut(s)	355
BlnI	CCTAGG	1 cut(s)	1402
BlpI	GCTNAGC	2 cut(s)	327, 2364
BmcAI	AGTACT	1 cut(s)	1265
Bme18I	GGWCC	6 cut(s)	1171, 1415, 1640, 1655, 1934, 3370
BmeRI	GACNNNNNGTC	1 cut(s)	399
BmgBI	CACGTC	2 cut(s)	2195, 2505
BmgT120I	GGNCC	8 cut(s)	466, 1171, 1415, 1640, 1655, 1934, 1964, 3370
BmsI	GCATC	4 cut(s)	692, 1324, 1854, 1989
BpiI	GAAGAC	4 cut(s)	2083, 2960, 3217, 3670
BpmI	CTGGAG	2 cut(s)	906, 2282
Bpu10I	CCTNAGC	6 cut(s)	1423, 2159, 3192, 3205, 3604, 3828
Bpu1102I	GCTNAGC	2 cut(s)	327, 2364
Bpu14I	TTCGAA	2 cut(s)	2795, 3589
BpuMI	CCSGG	6 cut(s)	44, 294, 343, 2304, 2746, 3522
Bsa29I	ATCGAT	1 cut(s)	1557
BsaAI	YACGTR	1 cut(s)	2863
BsaBI	GATNNNNATC	2 cut(s)	870, 3638
BsaJI	CCNNGG	9 cut(s)	107, 692, 1032, 1402, 1651, 1938, 2308, 2745, 3686
BsaWI	WCCGGW	4 cut(s)	1637, 1886, 3024, 3089
Bsc4I	CCNNNNNNNGG	6 cut(s)	345, 2309, 2964, 3277, 3649, 3969
Bse118I	RCCGGY	2 cut(s)	173, 1886
Bse1I	ACTGG	2 cut(s)	982, 2353
Bse21I	CCTNAGG	2 cut(s)	270, 714
Bse3DI	GCAATG	1 cut(s)	3460
Bse8I	GATNNNNATC	2 cut(s)	870, 3638
BseAI	TCCGGA	1 cut(s)	1637
BseBI	CCWGG	5 cut(s)	351, 693, 1023, 1776, 3687
BseCI	ATCGAT	1 cut(s)	1557
BseDI	CCNNGG	9 cut(s)	107, 692, 1032, 1402, 1651, 1938, 2308, 2745, 3686
BseJI	GATNNNNATC	2 cut(s)	870, 3638
BseLI	CCNNNNNNNGG	6 cut(s)	345, 2309, 2964, 3277, 3649, 3969
BseMI	GCAATG	1 cut(s)	3460
BseNI	ACTGG	2 cut(s)	982, 2353
BseRI	GAGGAG	1 cut(s)	3797
BseSI	GKGCMC	3 cut(s)	1390, 2047, 3539
BseYI	CCCAGC	1 cut(s)	3991
BsgI	GTGCAG	1 cut(s)	3783
Bsh1236I	CGCG	1 cut(s)	109
BshFI	GGCC	9 cut(s)	349, 467, 1789, 1965, 2065, 2307, 2858, 3019, 3506
BshNI	GGYRCC	3 cut(s)	170, 2351, 3574
BshTI	ACCGGT	1 cut(s)	1886
BshVI	ATCGAT	1 cut(s)	1557
BsiHKAI	GWGCWC	1 cut(s)	977
BslFI	GGGAC	4 cut(s)	1920, 2205, 3571, 4017
BslI	CCNNNNNNNGG	6 cut(s)	345, 2309, 2964, 3277, 3649, 3969
BsmAI	GTCTC	5 cut(s)	79, 1154, 1963, 3329, 3432
BsmFI	GGGAC	4 cut(s)	1920, 2205, 3571, 4017
BsmI	GAATGC	3 cut(s)	984, 3484, 3516
BsnI	GGCC	9 cut(s)	349, 467, 1789, 1965, 2065, 2307, 2858, 3019, 3506
Bsp119I	TTCGAA	2 cut(s)	2795, 3589
Bsp1286I	GDGCHC	4 cut(s)	977, 1390, 2047, 3539
Bsp13I	TCCGGA	1 cut(s)	1637
Bsp1407I	TGTACA	1 cut(s)	3707
Bsp1720I	GCTNAGC	2 cut(s)	327, 2364
Bsp19I	CCATGG	2 cut(s)	1651, 2308
BspANI	GGCC	9 cut(s)	349, 467, 1789, 1965, 2065, 2307, 2858, 3019, 3506
BspDI	ATCGAT	1 cut(s)	1557
BspEI	TCCGGA	1 cut(s)	1637
BspFNI	CGCG	1 cut(s)	109
BspHI	TCATGA	1 cut(s)	1551
BspMAI	CTGCAG	4 cut(s)	367, 373, 1194, 2527
BspMI	ACCTGC	3 cut(s)	322, 1666, 3755
BspT104I	TTCGAA	2 cut(s)	2795, 3589
BspT107I	GGYRCC	3 cut(s)	170, 2351, 3574
BsrBI	CCGCTC	2 cut(s)	2363, 3751
BsrDI	GCAATG	1 cut(s)	3460
BsrFI	RCCGGY	2 cut(s)	173, 1886
BsrGI	TGTACA	1 cut(s)	3707
BsrI	ACTGG	2 cut(s)	982, 2353
BssAI	RCCGGY	2 cut(s)	173, 1886
BssECI	CCNNGG	9 cut(s)	107, 692, 1032, 1402, 1651, 1938, 2308, 2745, 3686
BssSI	CACGAG	1 cut(s)	3834
BssT1I	CCWWGG	4 cut(s)	1402, 1651, 1938, 2308
Bst2BI	CACGAG	1 cut(s)	3834
Bst2UI	CCWGG	5 cut(s)	351, 693, 1023, 1776, 3687
Bst6I	CTCTTC	4 cut(s)	2242, 2341, 3351, 3752
BstAPI	GCANNNNNTGC	2 cut(s)	981, 1433
BstAUI	TGTACA	1 cut(s)	3707
BstBAI	YACGTR	1 cut(s)	2863
BstBI	TTCGAA	2 cut(s)	2795, 3589
BstC8I	GCNNGC	5 cut(s)	856, 2356, 3123, 3388, 3451
BstDSI	CCRYGG	3 cut(s)	107, 1651, 2308
BstEII	GGTNACC	1 cut(s)	2399
BstFNI	CGCG	1 cut(s)	109
BstHHI	GCGC	1 cut(s)	3821
BstMAI	GTCTC	5 cut(s)	79, 1154, 1963, 3329, 3432
BstNI	CCWGG	5 cut(s)	351, 693, 1023, 1776, 3687
BstNSI	RCATGY	1 cut(s)	733
BstPI	GGTNACC	1 cut(s)	2399
BstSFI	CTRYAG	4 cut(s)	363, 369, 1190, 2523
BstSLI	GKGCMC	3 cut(s)	1390, 2047, 3539
BstUI	CGCG	1 cut(s)	109
BstV2I	GAAGAC	4 cut(s)	2083, 2960, 3217, 3670
BstX2I	RGATCY	3 cut(s)	1219, 2022, 2461
BstXI	CCANNNNNNTGG	1 cut(s)	1282
BstYI	RGATCY	3 cut(s)	1219, 2022, 2461
Bsu15I	ATCGAT	1 cut(s)	1557
Bsu36I	CCTNAGG	2 cut(s)	270, 714
BsuI	GTATCC	1 cut(s)	1645
BsuRI	GGCC	9 cut(s)	349, 467, 1789, 1965, 2065, 2307, 2858, 3019, 3506
BsuTUI	ATCGAT	1 cut(s)	1557
BtgI	CCRYGG	3 cut(s)	107, 1651, 2308
BtrI	CACGTC	2 cut(s)	2195, 2505
BtsI	GCAGTG	1 cut(s)	966
BveI	ACCTGC	3 cut(s)	322, 1666, 3755
Cac8I	GCNNGC	5 cut(s)	856, 2356, 3123, 3388, 3451
CaiI	CAGNNNCTG	1 cut(s)	2522
CciI	TCATGA	1 cut(s)	1551
CfoI	GCGC	1 cut(s)	3821
Cfr10I	RCCGGY	2 cut(s)	173, 1886
Cfr13I	GGNCC	8 cut(s)	466, 1171, 1415, 1640, 1655, 1934, 1964, 3370
Cfr42I	CCGCGG	1 cut(s)	110
ClaI	ATCGAT	1 cut(s)	1557
CseI	GACGC	5 cut(s)	445, 1425, 1598, 1856, 2822
CsiI	ACCWGGT	1 cut(s)	1774
Csp6I	GTAC	8 cut(s)	141, 640, 1264, 1312, 1469, 1779, 2756, 3708
CspAI	ACCGGT	1 cut(s)	1886
CspCI	CAANNNNNGTGG	2 cut(s)	2068, 2103
CviQI	GTAC	8 cut(s)	141, 640, 1264, 1312, 1469, 1779, 2756, 3708
DrdI	GACNNNNNNGTC	1 cut(s)	2819
DriI	GACNNNNNGTC	1 cut(s)	399
DseDI	GACNNNNNNGTC	1 cut(s)	2819
EaeI	YGGCCR	3 cut(s)	2305, 3017, 3504
Eam1104I	CTCTTC	4 cut(s)	2242, 2341, 3351, 3752
Eam1105I	GACNNNNNGTC	1 cut(s)	399
EarI	CTCTTC	4 cut(s)	2242, 2341, 3351, 3752
Eco130I	CCWWGG	4 cut(s)	1402, 1651, 1938, 2308
Eco147I	AGGCCT	2 cut(s)	2065, 2858
Eco32I	GATATC	1 cut(s)	4024
Eco47I	GGWCC	6 cut(s)	1171, 1415, 1640, 1655, 1934, 3370
Eco57I	CTGAAG	6 cut(s)	396, 1614, 1776, 3236, 3927, 4007
Eco81I	CCTNAGG	2 cut(s)	270, 714
Eco91I	GGTNACC	1 cut(s)	2399
EcoO109I	RGGNCCY	2 cut(s)	1171, 3370
EcoO65I	GGTNACC	1 cut(s)	2399
EcoRI	GAATTC	2 cut(s)	115, 306
EcoRII	CCWGG	5 cut(s)	349, 691, 1021, 1774, 3685
EcoRV	GATATC	1 cut(s)	4024
EcoT14I	CCWWGG	4 cut(s)	1402, 1651, 1938, 2308
ErhI	CCWWGG	4 cut(s)	1402, 1651, 1938, 2308
FalI	AAGNNNNNCTT	2 cut(s)	52, 84
FaqI	GGGAC	4 cut(s)	1920, 2205, 3571, 4017
FauI	CCCGC	2 cut(s)	1881, 3383
FbaI	TGATCA	5 cut(s)	286, 580, 754, 1993, 2676
FblI	GTMKAC	2 cut(s)	459, 3974
FspAI	RTGCGCAY	1 cut(s)	3820
FspBI	CTAG	9 cut(s)	989, 1359, 1403, 1545, 1593, 1737, 2538, 2700, 3644
FspI	TGCGCA	1 cut(s)	3820
GlaI	GCGC	1 cut(s)	3820
GsaI	CCCAGC	1 cut(s)	3995
GsuI	CTGGAG	2 cut(s)	906, 2282
HaeIII	GGCC	9 cut(s)	349, 467, 1789, 1965, 2065, 2307, 2858, 3019, 3506
HgaI	GACGC	5 cut(s)	445, 1425, 1598, 1856, 2822
HhaI	GCGC	1 cut(s)	3821
Hin6I	GCGC	1 cut(s)	3819
HinP1I	GCGC	1 cut(s)	3819
HincII	GTYRAC	2 cut(s)	814, 1458
HindII	GTYRAC	2 cut(s)	814, 1458
HindIII	AAGCTT	2 cut(s)	856, 3202
HinfI	GANTC	8 cut(s)	825, 1454, 1691, 1881, 2174, 3005, 3043, 3733
Hpy166II	GTNNAC	9 cut(s)	460, 749, 814, 1208, 1458, 3283, 3527, 3659, 3975
Hpy8I	GTNNAC	9 cut(s)	460, 749, 814, 1208, 1458, 3283, 3527, 3659, 3975
Hpy99I	CGWCG	3 cut(s)	405, 2022, 2043
HpyCH4IV	ACGT	4 cut(s)	1684, 2194, 2504, 2862
HpySE526I	ACGT	4 cut(s)	1684, 2194, 2504, 2862
HspAI	GCGC	1 cut(s)	3819
Kpn2I	TCCGGA	1 cut(s)	1637
Ksp22I	TGATCA	5 cut(s)	286, 580, 754, 1993, 2676
KspI	CCGCGG	1 cut(s)	110
LmnI	GCTCC	9 cut(s)	938, 972, 1370, 1753, 2363, 2566, 2738, 2781, 3303
LweI	GCATC	4 cut(s)	692, 1324, 1854, 1989
MabI	ACCWGGT	1 cut(s)	1774
MaeI	CTAG	9 cut(s)	989, 1359, 1403, 1545, 1593, 1737, 2538, 2700, 3644
MaeII	ACGT	4 cut(s)	1684, 2194, 2504, 2862
MaeIII	GTNAC	8 cut(s)	274, 785, 1868, 1968, 2399, 2632, 2810, 2821
MbiI	CCGCTC	2 cut(s)	2363, 3751
MflI	RGATCY	3 cut(s)	1219, 2022, 2461
MhlI	GDGCHC	4 cut(s)	977, 1390, 2047, 3539
MlsI	TGGCCA	2 cut(s)	3019, 3506
MluNI	TGGCCA	2 cut(s)	3019, 3506
MlyI	GAGTC	1 cut(s)	1463
MmeI	TCCRAC	1 cut(s)	2000
Mox20I	TGGCCA	2 cut(s)	3019, 3506
MroI	TCCGGA	1 cut(s)	1637
MroXI	GAANNNNTTC	2 cut(s)	3585, 3732
MscI	TGGCCA	2 cut(s)	3019, 3506
MslI	CAYNNNNRTG	7 cut(s)	588, 768, 876, 2481, 2649, 3162, 3522
Msp20I	TGGCCA	2 cut(s)	3019, 3506
MspA1I	CMGCKG	4 cut(s)	109, 368, 374, 3608
Mva1269I	GAATGC	3 cut(s)	984, 3484, 3516
MvaI	CCWGG	5 cut(s)	351, 693, 1023, 1776, 3687
MvnI	CGCG	1 cut(s)	109
NciI	CCSGG	6 cut(s)	44, 294, 343, 2304, 2746, 3522
NcoI	CCATGG	2 cut(s)	1651, 2308
NmuCI	GTSAC	6 cut(s)	785, 1868, 2399, 2632, 2810, 2821
NsbI	TGCGCA	1 cut(s)	3820
NspI	RCATGY	1 cut(s)	733
NspV	TTCGAA	2 cut(s)	2795, 3589
PagI	TCATGA	1 cut(s)	1551
PaqCI	CACCTGC	1 cut(s)	3755
PceI	AGGCCT	2 cut(s)	2065, 2858
PcsI	WCGNNNNNNNCGW	2 cut(s)	2044, 3595
PctI	GAATGC	3 cut(s)	984, 3484, 3516
PdmI	GAANNNNTTC	2 cut(s)	3585, 3732
PfeI	GAWTC	7 cut(s)	825, 1691, 1881, 2174, 3005, 3043, 3733
PinAI	ACCGGT	1 cut(s)	1886
PleI	GAGTC	1 cut(s)	1462
PpsI	GAGTC	1 cut(s)	1462
Ppu21I	YACGTR	1 cut(s)	2863
PpuMI	RGGWCCY	2 cut(s)	1171, 3370
PshBI	ATTAAT	2 cut(s)	699, 2628
PsiI	TTATAA	1 cut(s)	2888
Psp5II	RGGWCCY	2 cut(s)	1171, 3370
Psp6I	CCWGG	5 cut(s)	349, 691, 1021, 1774, 3685
PspEI	GGTNACC	1 cut(s)	2399
PspFI	CCCAGC	1 cut(s)	3991
PspGI	CCWGG	5 cut(s)	349, 691, 1021, 1774, 3685
PspPI	GGNCC	8 cut(s)	466, 1171, 1415, 1640, 1655, 1934, 1964, 3370
PspPPI	RGGWCCY	2 cut(s)	1171, 3370
PstI	CTGCAG	4 cut(s)	367, 373, 1194, 2527
PstNI	CAGNNNCTG	1 cut(s)	2522
PsuI	RGATCY	3 cut(s)	1219, 2022, 2461
PvuII	CAGCTG	3 cut(s)	368, 374, 3608
RsaI	GTAC	8 cut(s)	142, 641, 1265, 1313, 1470, 1780, 2757, 3709
RsaNI	GTAC	8 cut(s)	141, 640, 1264, 1312, 1469, 1779, 2756, 3708
RseI	CAYNNNNRTG	7 cut(s)	588, 768, 876, 2481, 2649, 3162, 3522
SacII	CCGCGG	1 cut(s)	110
Sau96I	GGNCC	8 cut(s)	466, 1171, 1415, 1640, 1655, 1934, 1964, 3370
ScaI	AGTACT	1 cut(s)	1265
SchI	GAGTC	1 cut(s)	1463
SduI	GDGCHC	4 cut(s)	977, 1390, 2047, 3539
SexAI	ACCWGGT	1 cut(s)	1774
SfaNI	GCATC	4 cut(s)	692, 1324, 1854, 1989
SfcI	CTRYAG	4 cut(s)	363, 369, 1190, 2523
Sfr303I	CCGCGG	1 cut(s)	110
SfuI	TTCGAA	2 cut(s)	2795, 3589
SgrAI	CRCCGGYG	1 cut(s)	1886
SgrBI	CCGCGG	1 cut(s)	110
SinI	GGWCC	6 cut(s)	1171, 1415, 1640, 1655, 1934, 3370
SmiMI	CAYNNNNRTG	7 cut(s)	588, 768, 876, 2481, 2649, 3162, 3522
SpeI	ACTAGT	1 cut(s)	2537
SseBI	AGGCCT	2 cut(s)	2065, 2858
SspI	AATATT	1 cut(s)	3014
SspMI	CTAG	9 cut(s)	989, 1359, 1403, 1545, 1593, 1737, 2538, 2700, 3644
StuI	AGGCCT	2 cut(s)	2065, 2858
StyI	CCWWGG	4 cut(s)	1402, 1651, 1938, 2308
TaiI	ACGT	4 cut(s)	1687, 2197, 2507, 2865
TaqII	GACCGA	2 cut(s)	3682, 3891
TatI	WGTACW	3 cut(s)	1263, 1468, 3707
TauI	GCSGC	1 cut(s)	341
TfiI	GAWTC	7 cut(s)	825, 1691, 1881, 2174, 3005, 3043, 3733
TseFI	GTSAC	6 cut(s)	785, 1868, 2399, 2632, 2810, 2821
Tsp45I	GTSAC	6 cut(s)	785, 1868, 2399, 2632, 2810, 2821
TspGWI	ACGGA	4 cut(s)	637, 1595, 2999, 3071
VpaK11BI	GGWCC	6 cut(s)	1171, 1415, 1640, 1655, 1934, 3370
VspI	ATTAAT	2 cut(s)	699, 2628
XceI	RCATGY	1 cut(s)	733
XcmI	CCANNNNNNNNNTGG	2 cut(s)	1279, 2306
XmaJI	CCTAGG	1 cut(s)	1402
XmiI	GTMKAC	2 cut(s)	459, 3974
XmnI	GAANNNNTTC	2 cut(s)	3585, 3732
XspI	CTAG	9 cut(s)	989, 1359, 1403, 1545, 1593, 1737, 2538, 2700, 3644
ZrmI	AGTACT	1 cut(s)	1265

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.