Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000010.1

Orthogroup ID

OG0008802

Physical Location & Seq

Genomic Coordinates Reverse (-)

106574 .. 107867

Gene Structure 1294 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000010.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

atgagtgcaagtagcttggttgcagaggcagtctggaaggccattgaatcagctggttcagtgaccgatgaacagctttccatgttgcatttcttgtttggtaagaacttggagcgagcgactaggatagtcgatcaaagaggtgtcaagaggattttcggtgagcccagtggacattctatatttcaggttgtaggagaatcccgaaggaaggaggaatacttttgttttgctgaacactattgcgcttgttattcattcttctatgacattgtaaacagaggagagcagctttgttgtaagcatcagttggctgcaagacttgctgcagcattgggagcatgcattgaagataaggtatctgatgagcagttagctctactgctttccaagctatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000724 GO:0000725 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009987 GO:0033554 GO:0034641 GO:0043170 GO:0044237 GO:0044238 GO:0044260 GO:0046483 GO:0050896 GO:0051716 GO:0071704 GO:0090304 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

132

Amino Acids

14.75

Weight (kDa)

6.07

Isoelectric Point (pI)

45.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008802)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33925 AT4G33925
fragaria_vesca	FvH4_2g04570
malus_domestica	MD00G1205200.v1.1 MD10G1101800.v1.1
prunus_persica	Prupe.8G139500_v2.0.a1 Prupe.8G139500_v2.0.a1 Prupe.8G139500_v2.0.a1 Prupe.8G139500_v2.0.a1
pyrus_communis	pycom10g08720
rosa_chinensis	RchiOBHm_Chr6g0254151
rosa_laevigata	RLG00000014939
rosa_multiflora	Rmu_sc0000010.1_g000027 Rmu_sc0003711.1_g000002
rosa_roxburghii	Rroxscaffold_7G00211120
rosa_rugosa	Rorug05G0550100 Rorug05G0550200
rosa_samantha	Rh6AG066600 Rh6BG059700 Rh6CG059400 Rh6DG056300 Rh6DG056600
rosa_wichuraiana	Rw6G005850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	211
AgsI	TTSAA	2 cut(s)	47, 350
AluBI	AGCT	6 cut(s)	15, 53, 76, 292, 377, 394
AluI	AGCT	6 cut(s)	15, 53, 76, 292, 377, 394
AoxI	GGCC	1 cut(s)	39
ApeKI	GCWGC	4 cut(s)	289, 314, 326, 329
AspLEI	GCGC	1 cut(s)	248
AsuHPI	GGTGA	1 cut(s)	173
BanII	GRGCYC	1 cut(s)	168
BarI	GAAGNNNNNNTAC	2 cut(s)	203, 235
BbvI	GCAGC	4 cut(s)	301, 301, 313, 341
BfaI	CTAG	1 cut(s)	123
BfmI	CTRYAG	1 cut(s)	327
BisI	GCNGC	4 cut(s)	290, 315, 327, 330
BlsI	GCNGC	4 cut(s)	291, 316, 328, 331
BmrI	ACTGGG	1 cut(s)	162
BmsI	GCATC	1 cut(s)	313
BmuI	ACTGGG	1 cut(s)	162
Bsc4I	CCNNNNNNNGG	1 cut(s)	211
Bse1I	ACTGG	1 cut(s)	168
BseLI	CCNNNNNNNGG	1 cut(s)	211
BseNI	ACTGG	1 cut(s)	168
BseRI	GAGGAG	1 cut(s)	297
BseXI	GCAGC	4 cut(s)	301, 301, 313, 341
BshFI	GGCC	1 cut(s)	41
BslI	CCNNNNNNNGG	1 cut(s)	211
BsnI	GGCC	1 cut(s)	41
Bsp1286I	GDGCHC	1 cut(s)	168
Bsp143I	GATC	1 cut(s)	133
BspANI	GGCC	1 cut(s)	41
BspMAI	CTGCAG	1 cut(s)	331
BsrI	ACTGG	1 cut(s)	168
BssMI	GATC	1 cut(s)	133
BstAPI	GCANNNNNTGC	1 cut(s)	323
BstC8I	GCNNGC	2 cut(s)	117, 343
BstHHI	GCGC	1 cut(s)	248
BstKTI	GATC	1 cut(s)	136
BstMBI	GATC	1 cut(s)	133
BstMWI	GCNNNNNNNGC	3 cut(s)	323, 338, 391
BstNSI	RCATGY	1 cut(s)	345
BstSFI	CTRYAG	1 cut(s)	327
BstV1I	GCAGC	4 cut(s)	301, 301, 313, 341
BsuRI	GGCC	1 cut(s)	41
BtsIMutI	CAGTG	2 cut(s)	66, 175
Cac8I	GCNNGC	2 cut(s)	117, 343
CfoI	GCGC	1 cut(s)	248
CviAII	CATG	2 cut(s)	82, 342
CviJI	RGCY	9 cut(s)	15, 41, 53, 76, 166, 292, 314, 377, 394
CviKI_1	RGCY	9 cut(s)	15, 41, 53, 76, 166, 292, 314, 377, 394
DpnI	GATC	1 cut(s)	135
DpnII	GATC	1 cut(s)	133
Eco24I	GRGCYC	1 cut(s)	168
EcoT22I	ATGCAT	1 cut(s)	347
EcoT38I	GRGCYC	1 cut(s)	168
FaeI	CATG	2 cut(s)	85, 345
FaiI	YATR	5 cut(s)	83, 182, 267, 343, 397
FatI	CATG	2 cut(s)	81, 341
Fnu4HI	GCNGC	4 cut(s)	290, 315, 327, 330
FriOI	GRGCYC	1 cut(s)	168
Fsp4HI	GCNGC	4 cut(s)	290, 315, 327, 330
FspBI	CTAG	1 cut(s)	123
GlaI	GCGC	1 cut(s)	247
GluI	GCNGC	4 cut(s)	290, 315, 327, 330
HaeIII	GGCC	1 cut(s)	41
HhaI	GCGC	1 cut(s)	248
Hin1II	CATG	2 cut(s)	85, 345
Hin6I	GCGC	1 cut(s)	246
HinP1I	GCGC	1 cut(s)	246
HinfI	GANTC	2 cut(s)	47, 200
HphI	GGTGA	1 cut(s)	173
Hpy166II	GTNNAC	2 cut(s)	173, 277
Hpy188I	TCNGA	1 cut(s)	364
Hpy188III	TCNNGA	3 cut(s)	34, 148, 204
Hpy8I	GTNNAC	2 cut(s)	173, 277
HpyAV	CCTTC	3 cut(s)	31, 201, 205
HpyCH4V	TGCA	6 cut(s)	8, 23, 88, 317, 329, 345
HpyF10VI	GCNNNNNNNGC	3 cut(s)	323, 338, 391
Hsp92II	CATG	2 cut(s)	85, 345
HspAI	GCGC	1 cut(s)	246
Kzo9I	GATC	1 cut(s)	133
LmnI	GCTCC	2 cut(s)	112, 338
LpnPI	CCDG	4 cut(s)	19, 39, 173, 181
Lsp1109I	GCAGC	4 cut(s)	301, 301, 313, 341
LweI	GCATC	1 cut(s)	313
MaeI	CTAG	1 cut(s)	123
MaeIII	GTNAC	1 cut(s)	61
MalI	GATC	1 cut(s)	135
MboI	GATC	1 cut(s)	133
MboII	GAAGA	2 cut(s)	253, 362
MhlI	GDGCHC	1 cut(s)	168
MnlI	CCTC	5 cut(s)	19, 134, 144, 208, 275
Mph1103I	ATGCAT	1 cut(s)	347
MspA1I	CMGCKG	1 cut(s)	53
MwoI	GCNNNNNNNGC	3 cut(s)	323, 338, 391
NdeII	GATC	1 cut(s)	133
NlaIII	CATG	2 cut(s)	85, 345
NmuCI	GTSAC	1 cut(s)	61
NsiI	ATGCAT	1 cut(s)	347
NspI	RCATGY	1 cut(s)	345
PaeI	GCATGC	1 cut(s)	345
PfeI	GAWTC	2 cut(s)	47, 200
PkrI	GCNGC	4 cut(s)	291, 316, 328, 331
PstI	CTGCAG	1 cut(s)	331
PvuII	CAGCTG	1 cut(s)	53
SatI	GCNGC	4 cut(s)	290, 315, 327, 330
Sau3AI	GATC	1 cut(s)	133
SduI	GDGCHC	1 cut(s)	168
SetI	ASST	9 cut(s)	17, 55, 78, 145, 192, 294, 360, 379, 396
SfaNI	GCATC	1 cut(s)	313
SfcI	CTRYAG	1 cut(s)	327
SphI	GCATGC	1 cut(s)	345
SspMI	CTAG	1 cut(s)	123
TaqI	TCGA	1 cut(s)	132
TaqII	GACCGA	1 cut(s)	80
TfiI	GAWTC	2 cut(s)	47, 200
TscAI	CASTG	2 cut(s)	66, 175
TseFI	GTSAC	1 cut(s)	61
TseI	GCWGC	4 cut(s)	289, 314, 326, 329
Tsp45I	GTSAC	1 cut(s)	61
TspDTI	ATGAA	2 cut(s)	84, 246
TspRI	CASTG	2 cut(s)	66, 175
XceI	RCATGY	1 cut(s)	345
XspI	CTAG	1 cut(s)	123
Zsp2I	ATGCAT	1 cut(s)	347

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.