Rmu_sc0000258.1_g000014

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000258.1
OG0021628
Physical Location & Seq
Reverse (-)
68564 .. 72403
3840 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 822 bp
atgggatgctcatcaaagctttgcaccatttcatgtgtcaactggtttgaagactcaacttattactacaattttttgggattaaaggagaatttcccagctgatatccttcaaaccgcaagagttttggcacagagggatgtcttgacatgtaacttatatcttgacaccatggcagattactacattgtcctctactttgctgggattctacctatgtttccttcagtcgacatcctgcttaatggtgatgtagcaaaatcaaattatactgcgccgttgccggacgggacagaattgaccttgtgtccggagagtggtccggtcggagtagtggttgcggggcgacggagatgcacaccagagagccggactgcgtacggtagaggcgggaagacggcaggggtttgggaggcgacaattcacttgttgcttcctgggtttgggaggagcatggagggcttgctcggtgtttcgagatcggatcggttgatcccgatctgggttgagtgtttcgttttcgacatgaggaaggacggcgtggcttgctggcggaaggtaggagacggaggtgcgccggcgagatgcgaaattatctctttacttggtaacttttggtggggatcaagtgagagaggccacaagatccattggaagagctggaaaagttcagggcttgcaaaggatgagggaggtatgggcttcagagagttacaagatttcaacatggcacttccagccaaacaatgctggagattaatacaagatcctcaatctctatgggcaagagttcttaaaggccgatactttcctggactgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

273

Amino Acids

30.46

Weight (kDa)

8.29

Isoelectric Point (pI)

48.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 231
AccIII TCCGGA 1 cut(s) 310
AciI CCGC 4 cut(s) 117, 341, 390, 553
AclWI GGATC 5 cut(s) 487, 492, 631, 640, 761
AcsI RAATTY 1 cut(s) 91
AcuI CTGAAG 2 cut(s) 210, 688
AfaI GTAC 1 cut(s) 380
AfiI CCNNNNNNNGG 3 cut(s) 317, 443, 502
AflIII ACRYGT 1 cut(s) 149
AgsI TTSAA 3 cut(s) 50, 113, 724
AhdI GACNNNNNGTC 1 cut(s) 306
AjnI CCWGG 2 cut(s) 436, 811
AluBI AGCT 3 cut(s) 19, 101, 660
AluI AGCT 3 cut(s) 19, 101, 660
Alw26I GTCTC 1 cut(s) 558
AlwI GGATC 5 cut(s) 487, 492, 631, 640, 761
Aor13HI TCCGGA 1 cut(s) 310
AoxI GGCC 2 cut(s) 637, 799
ApoI RAATTY 1 cut(s) 91
AseI ATTAAT 1 cut(s) 758
AspLEI GCGC 2 cut(s) 277, 577
AspS9I GGNCC 1 cut(s) 320
AsuHPI GGTGA 1 cut(s) 260
AvaII GGWCC 1 cut(s) 320
BbsI GAAGAC 2 cut(s) 57, 401
BceAI ACGGC 3 cut(s) 262, 414, 553
BcgI CGANNNNNNTGC 2 cut(s) 336, 370
BciT130I CCWGG 2 cut(s) 438, 813
BcoDI GTCTC 1 cut(s) 558
Bme1390I CCNGG 2 cut(s) 438, 813
Bme18I GGWCC 1 cut(s) 320
BmeRI GACNNNNNGTC 1 cut(s) 306
BmgT120I GGNCC 1 cut(s) 320
BmrFI CCNGG 2 cut(s) 438, 813
BmsI GCATC 2 cut(s) 344, 575
BpiI GAAGAC 2 cut(s) 57, 401
BpmI CTGGAG 1 cut(s) 772
BsaBI GATNNNNATC 2 cut(s) 10, 497
BsaJI CCNNGG 2 cut(s) 171, 437
BsaWI WCCGGW 2 cut(s) 310, 322
BsaXI ACNNNNNCTCC 2 cut(s) 321, 351
Bsc4I CCNNNNNNNGG 3 cut(s) 317, 443, 502
Bse118I RCCGGY 1 cut(s) 577
Bse1I ACTGG 1 cut(s) 47
Bse8I GATNNNNATC 2 cut(s) 10, 497
BseAI TCCGGA 1 cut(s) 310
BseBI CCWGG 2 cut(s) 438, 813
BseDI CCNNGG 2 cut(s) 171, 437
BseGI GGATG 4 cut(s) 11, 145, 234, 691
BseJI GATNNNNATC 2 cut(s) 10, 497
BseLI CCNNNNNNNGG 3 cut(s) 317, 443, 502
BseNI ACTGG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 463
BseYI CCCAGC 2 cut(s) 97, 203
Bsh1285I CGRYCG 1 cut(s) 327
BshFI GGCC 2 cut(s) 639, 801
BsiEI CGRYCG 1 cut(s) 327
BsiSI CCGG 5 cut(s) 284, 311, 323, 370, 578
BsiWI CGTACG 1 cut(s) 378
BslFI GGGAC 1 cut(s) 304
BslI CCNNNNNNNGG 3 cut(s) 317, 443, 502
BsmAI GTCTC 1 cut(s) 558
BsmBI CGTCTC 1 cut(s) 558
BsmFI GGGAC 1 cut(s) 304
BsnI GGCC 2 cut(s) 639, 801
Bsp13I TCCGGA 1 cut(s) 310
Bsp143I GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
Bsp19I CCATGG 1 cut(s) 171
BspACI CCGC 4 cut(s) 117, 341, 390, 553
BspANI GGCC 2 cut(s) 639, 801
BspEI TCCGGA 1 cut(s) 310
BspPI GGATC 5 cut(s) 487, 492, 631, 640, 761
BspQI GCTCTTC 1 cut(s) 650
BsrFI RCCGGY 1 cut(s) 577
BsrI ACTGG 1 cut(s) 47
BssAI RCCGGY 1 cut(s) 577
BssECI CCNNGG 2 cut(s) 171, 437
BssMI GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
BssT1I CCWWGG 1 cut(s) 171
Bst2UI CCWGG 2 cut(s) 438, 813
Bst4CI ACNGT 2 cut(s) 383, 819
Bst6I CTCTTC 1 cut(s) 650
BstC8I GCNNGC 5 cut(s) 464, 547, 551, 579, 678
BstDSI CCRYGG 1 cut(s) 171
BstF5I GGATG 4 cut(s) 11, 145, 234, 691
BstHHI GCGC 2 cut(s) 277, 577
BstKTI GATC 7 cut(s) 482, 487, 495, 501, 626, 648, 769
BstMAI GTCTC 1 cut(s) 558
BstMBI GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
BstMCI CGRYCG 1 cut(s) 327
BstMWI GCNNNNNNNGC 3 cut(s) 459, 546, 737
BstNI CCWGG 2 cut(s) 438, 813
BstNSI RCATGY 1 cut(s) 153
BstSCI CCNGG 2 cut(s) 436, 811
BstV2I GAAGAC 2 cut(s) 57, 401
BstX2I RGATCY 2 cut(s) 645, 766
BstYI RGATCY 2 cut(s) 645, 766
BsuRI GGCC 2 cut(s) 639, 801
BtgI CCRYGG 1 cut(s) 171
BtsCI GGATG 4 cut(s) 11, 145, 234, 691
Cac8I GCNNGC 5 cut(s) 464, 547, 551, 579, 678
CfoI GCGC 2 cut(s) 277, 577
Cfr10I RCCGGY 1 cut(s) 577
Cfr13I GGNCC 1 cut(s) 320
Csp6I GTAC 1 cut(s) 379
CviAII CATG 6 cut(s) 33, 150, 172, 454, 526, 727
CviQI GTAC 1 cut(s) 379
DpnI GATC 7 cut(s) 481, 486, 494, 500, 625, 647, 768
DpnII GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
DriI GACNNNNNGTC 1 cut(s) 306
Eam1104I CTCTTC 1 cut(s) 650
Eam1105I GACNNNNNGTC 1 cut(s) 306
EarI CTCTTC 1 cut(s) 650
EciI GGCGGA 1 cut(s) 568
Eco130I CCWWGG 1 cut(s) 171
Eco32I GATATC 1 cut(s) 106
Eco47I GGWCC 1 cut(s) 320
Eco57I CTGAAG 2 cut(s) 210, 688
EcoRII CCWGG 2 cut(s) 436, 811
EcoRV GATATC 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
Esp3I CGTCTC 1 cut(s) 558
FaeI CATG 6 cut(s) 36, 153, 175, 457, 529, 730
FaqI GGGAC 1 cut(s) 304
FatI CATG 6 cut(s) 32, 149, 171, 453, 525, 726
FauI CCCGC 2 cut(s) 334, 383
FblI GTMKAC 1 cut(s) 231
FokI GGATG 4 cut(s) 18, 152, 221, 698
GlaI GCGC 2 cut(s) 276, 576
GsaI CCCAGC 2 cut(s) 101, 207
GsuI CTGGAG 1 cut(s) 772
HaeIII GGCC 2 cut(s) 639, 801
HapII CCGG 5 cut(s) 284, 311, 323, 370, 578
HhaI GCGC 2 cut(s) 277, 577
Hin1II CATG 6 cut(s) 36, 153, 175, 457, 529, 730
Hin6I GCGC 2 cut(s) 275, 575
HinP1I GCGC 2 cut(s) 275, 575
HincII GTYRAC 2 cut(s) 40, 232
HindII GTYRAC 2 cut(s) 40, 232
HindIII AAGCTT 1 cut(s) 17
HinfI GANTC 2 cut(s) 53, 208
HpaII CCGG 5 cut(s) 284, 311, 323, 370, 578
HphI GGTGA 1 cut(s) 260
Hpy166II GTNNAC 2 cut(s) 40, 232
Hpy188I TCNGA 3 cut(s) 329, 484, 707
Hpy188III TCNNGA 5 cut(s) 145, 164, 311, 477, 496
Hpy8I GTNNAC 2 cut(s) 40, 232
Hpy99I CGWCG 1 cut(s) 351
HpyAV CCTTC 4 cut(s) 119, 234, 526, 550
HpyCH4III ACNGT 2 cut(s) 383, 819
HpyCH4V TGCA 3 cut(s) 24, 357, 680
HpyF10VI GCNNNNNNNGC 3 cut(s) 459, 546, 737
Hsp92II CATG 6 cut(s) 36, 153, 175, 457, 529, 730
HspAI GCGC 2 cut(s) 275, 575
Kpn2I TCCGGA 1 cut(s) 310
KroI GCCGGC 1 cut(s) 577
KroNI GCCGGC 1 cut(s) 579
Kzo9I GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
LguI GCTCTTC 1 cut(s) 650
LmnI GCTCC 1 cut(s) 450
LweI GCATC 2 cut(s) 344, 575
MaeIII GTNAC 3 cut(s) 152, 608, 711
MalI GATC 7 cut(s) 481, 486, 494, 500, 625, 647, 768
MboI GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
MboII GAAGA 3 cut(s) 62, 406, 667
MflI RGATCY 2 cut(s) 645, 766
MluCI AATT 6 cut(s) 70, 91, 265, 296, 420, 591
MlyI GAGTC 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 307
MreI CGCCGGCG 1 cut(s) 577
MroI TCCGGA 1 cut(s) 310
MroNI GCCGGC 1 cut(s) 577
MseI TTAA 4 cut(s) 83, 243, 758, 795
MspA1I CMGCKG 1 cut(s) 101
MspI CCGG 5 cut(s) 284, 311, 323, 370, 578
MspR9I CCNGG 2 cut(s) 438, 813
MvaI CCWGG 2 cut(s) 438, 813
MwoI GCNNNNNNNGC 3 cut(s) 459, 546, 737
NaeI GCCGGC 1 cut(s) 579
NcoI CCATGG 1 cut(s) 171
NdeII GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
NgoMIV GCCGGC 1 cut(s) 577
NlaIII CATG 6 cut(s) 36, 153, 175, 457, 529, 730
NspI RCATGY 1 cut(s) 153
PciI ACATGT 1 cut(s) 149
PciSI GCTCTTC 1 cut(s) 650
PdiI GCCGGC 1 cut(s) 579
PfeI GAWTC 1 cut(s) 208
Pfl23II CGTACG 1 cut(s) 378
PfoI TCCNGGA 1 cut(s) 811
PleI GAGTC 1 cut(s) 47
PpsI GAGTC 1 cut(s) 47
PscI ACATGT 1 cut(s) 149
PshBI ATTAAT 1 cut(s) 758
Psp6I CCWGG 2 cut(s) 436, 811
PspFI CCCAGC 2 cut(s) 97, 203
PspGI CCWGG 2 cut(s) 436, 811
PspLI CGTACG 1 cut(s) 378
PspPI GGNCC 1 cut(s) 320
PsuI RGATCY 2 cut(s) 645, 766
PvuII CAGCTG 1 cut(s) 101
RsaI GTAC 1 cut(s) 380
RsaNI GTAC 1 cut(s) 379
SalI GTCGAC 1 cut(s) 230
SapI GCTCTTC 1 cut(s) 650
SaqAI TTAA 4 cut(s) 83, 243, 758, 795
Sau3AI GATC 7 cut(s) 479, 484, 492, 498, 623, 645, 766
Sau96I GGNCC 1 cut(s) 320
SchI GAGTC 1 cut(s) 47
ScrFI CCNGG 2 cut(s) 438, 813
SetI ASST 8 cut(s) 21, 103, 217, 305, 561, 574, 662, 697
SfaNI GCATC 2 cut(s) 344, 575
SgrAI CRCCGGYG 1 cut(s) 577
SinI GGWCC 1 cut(s) 320
Sse9I AATT 6 cut(s) 70, 91, 265, 296, 420, 591
SsiI CCGC 4 cut(s) 117, 341, 390, 553
StyD4I CCNGG 2 cut(s) 436, 811
StyI CCWWGG 1 cut(s) 171
TaaI ACNGT 2 cut(s) 383, 819
TaqI TCGA 3 cut(s) 231, 476, 522
TasI AATT 6 cut(s) 70, 91, 265, 296, 420, 591
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 4 cut(s) 83, 243, 758, 795
Tru9I TTAA 4 cut(s) 83, 243, 758, 795
TspDTI ATGAA 1 cut(s) 21
TspGWI ACGGA 2 cut(s) 364, 582
VpaK11BI GGWCC 1 cut(s) 320
VspI ATTAAT 1 cut(s) 758
XapI RAATTY 1 cut(s) 91
XceI RCATGY 1 cut(s) 153
XmiI GTMKAC 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.