Rmu_sc0000258.1_g000065

UPF0496 protein At4g34320-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000258.1
OG0020649
Physical Location & Seq
Reverse (-)
289437 .. 290216
780 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 780 bp
atgtgcaagcgtgatagagatatctggagatcatataacaaggcttgcaagaatgatgaggctttcttaactgaattaggcaagttcctcgagtcgtatgagaaatgtataactcaacttaaggggatggaagaaaaaggcagaggaagtgatatcagctacatgaggaatattttagaggaactgaagcagcgttctgctgtggatcaaaggttgatcgaaaaggttacacgtttgatcaaggagcgagaagatatgcatgatcaattgacaagccaaaaagagaagcctggcaagaagtatggttgtgctcgcgcttggagacgctgtttgaggatggtcacttatgttgtgttcattggtgctgtggctgctgaatttgcttgcacagttatggctgcagttctggctgctccacttatttctctagccattgcagctgtcattatcccaacactagccggacaacactggactctatcttggattaaagaatctccttttgagaatcaggtcaatgtgattcgcgtcatgcaaccagcaattacacatcacattatggagttgcaagacacacatagaggtatcagggttgtttcaaaagacataaactcactcttggaccttctgaactctgtaattgagggagaagacgacttcactatgaaagagatcgagagtcctctggagcaccttaataatttgaaggaaagagcaaggtattgtaagtccatgatattgaacgcaagagctgacgtgtctaagaaactgcgaagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF677

Protein Analysis

259

Amino Acids

29.83

Weight (kDa)

9.0

Isoelectric Point (pI)

47.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF677 PF05055 49 - 255 1.4e-12 Protein of unknown function (DUF677)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020649)

Species Orthologous Gene IDs
rosa_laevigata RLG00000013219
rosa_multiflora Rmu_sc0000258.1_g000065
rosa_roxburghii Rroxscaffold_7G00189990 Rroxscaffold_7G00190230
rosa_samantha Rh6BG231400
rosa_wichuraiana Rw6G019860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 315, 528
AclWI GGATC 1 cut(s) 213
AcsI RAATTY 1 cut(s) 377
AcuI CTGAAG 1 cut(s) 206
AflII CTTAAG 1 cut(s) 119
AflIII ACRYGT 2 cut(s) 230, 756
AgsI TTSAA 3 cut(s) 600, 706, 742
AjiI CACGTC 1 cut(s) 757
AjnI CCWGG 1 cut(s) 289
AluBI AGCT 3 cut(s) 159, 440, 752
AluI AGCT 3 cut(s) 159, 440, 752
Alw21I GWGCWC 2 cut(s) 313, 693
Alw26I GTCTC 1 cut(s) 316
AlwI GGATC 1 cut(s) 213
Ama87I CYCGRG 1 cut(s) 89
ApeKI GCWGC 5 cut(s) 190, 371, 398, 410, 437
ApoI RAATTY 1 cut(s) 377
AspLEI GCGC 1 cut(s) 317
AspS9I GGNCC 1 cut(s) 622
AvaI CYCGRG 1 cut(s) 89
AvaII GGWCC 1 cut(s) 622
BbsI GAAGAC 1 cut(s) 657
Bbv12I GWGCWC 2 cut(s) 313, 693
BbvI GCAGC 5 cut(s) 202, 358, 385, 397, 449
BccI CCATC 2 cut(s) 121, 331
BcgI CGANNNNNNTGC 2 cut(s) 70, 104
BciT130I CCWGG 1 cut(s) 291
BclI TGATCA 2 cut(s) 237, 262
BcoDI GTCTC 1 cut(s) 316
BfaI CTAG 2 cut(s) 428, 458
BfmI CTRYAG 1 cut(s) 399
BfrI CTTAAG 1 cut(s) 119
BisI GCNGC 5 cut(s) 191, 372, 399, 411, 438
BlsI GCNGC 5 cut(s) 192, 373, 400, 412, 439
Bme1390I CCNGG 1 cut(s) 291
Bme18I GGWCC 1 cut(s) 622
BmeT110I CYCGRG 1 cut(s) 89
BmgBI CACGTC 1 cut(s) 757
BmgT120I GGNCC 1 cut(s) 622
BmrFI CCNGG 1 cut(s) 291
BpiI GAAGAC 1 cut(s) 657
BpmI CTGGAG 2 cut(s) 46, 707
BsaXI ACNNNNNCTCC 2 cut(s) 313, 343
Bse1I ACTGG 1 cut(s) 476
Bse3DI GCAATG 1 cut(s) 432
BseBI CCWGG 1 cut(s) 291
BseGI GGATG 2 cut(s) 132, 342
BseMI GCAATG 1 cut(s) 432
BseNI ACTGG 1 cut(s) 476
BseXI GCAGC 5 cut(s) 202, 358, 385, 397, 449
Bsh1236I CGCG 2 cut(s) 315, 528
BsiHKAI GWGCWC 2 cut(s) 313, 693
BsiHKCI CYCGRG 1 cut(s) 89
BsiSI CCGG 1 cut(s) 462
BsmAI GTCTC 1 cut(s) 316
BsmBI CGTCTC 1 cut(s) 316
BsoBI CYCGRG 1 cut(s) 89
Bsp1286I GDGCHC 2 cut(s) 313, 693
Bsp143I GATC 6 cut(s) 29, 205, 216, 237, 262, 672
BspFNI CGCG 2 cut(s) 315, 528
BspMAI CTGCAG 1 cut(s) 403
BspPI GGATC 1 cut(s) 213
BspTI CTTAAG 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 432
BsrI ACTGG 1 cut(s) 476
BssMI GATC 6 cut(s) 29, 205, 216, 237, 262, 672
Bst2UI CCWGG 1 cut(s) 291
Bst4CI ACNGT 1 cut(s) 391
BstAFI CTTAAG 1 cut(s) 119
BstC8I GCNNGC 4 cut(s) 8, 46, 313, 385
BstDEI CTNAG 1 cut(s) 762
BstF5I GGATG 2 cut(s) 132, 342
BstFNI CGCG 2 cut(s) 315, 528
BstHHI GCGC 1 cut(s) 317
BstKTI GATC 6 cut(s) 32, 208, 219, 240, 265, 675
BstMAI GTCTC 1 cut(s) 316
BstMBI GATC 6 cut(s) 29, 205, 216, 237, 262, 672
BstMWI GCNNNNNNNGC 4 cut(s) 371, 380, 407, 437
BstNI CCWGG 1 cut(s) 291
BstSCI CCNGG 1 cut(s) 289
BstSFI CTRYAG 1 cut(s) 399
BstUI CGCG 2 cut(s) 315, 528
BstV1I GCAGC 5 cut(s) 202, 358, 385, 397, 449
BstV2I GAAGAC 1 cut(s) 657
BtrI CACGTC 1 cut(s) 757
BtsCI GGATG 2 cut(s) 132, 342
BtsIMutI CAGTG 1 cut(s) 469
Cac8I GCNNGC 4 cut(s) 8, 46, 313, 385
CfoI GCGC 1 cut(s) 317
Cfr13I GGNCC 1 cut(s) 622
CseI GACGC 2 cut(s) 333, 517
CviAII CATG 4 cut(s) 163, 260, 532, 733
DdeI CTNAG 1 cut(s) 762
DpnI GATC 6 cut(s) 31, 207, 218, 239, 264, 674
DpnII GATC 6 cut(s) 29, 205, 216, 237, 262, 672
Eco32I GATATC 2 cut(s) 22, 154
Eco47I GGWCC 1 cut(s) 622
Eco57I CTGAAG 1 cut(s) 206
Eco88I CYCGRG 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 289
EcoRV GATATC 2 cut(s) 22, 154
EcoT22I ATGCAT 1 cut(s) 261
Esp3I CGTCTC 1 cut(s) 316
FaeI CATG 4 cut(s) 166, 263, 535, 736
FatI CATG 4 cut(s) 162, 259, 531, 732
FbaI TGATCA 2 cut(s) 237, 262
Fnu4HI GCNGC 5 cut(s) 191, 372, 399, 411, 438
FokI GGATG 2 cut(s) 139, 349
Fsp4HI GCNGC 5 cut(s) 191, 372, 399, 411, 438
FspBI CTAG 2 cut(s) 428, 458
GlaI GCGC 1 cut(s) 316
GluI GCNGC 5 cut(s) 191, 372, 399, 411, 438
GsuI CTGGAG 2 cut(s) 46, 707
HapII CCGG 1 cut(s) 462
HgaI GACGC 2 cut(s) 333, 517
HhaI GCGC 1 cut(s) 317
Hin1II CATG 4 cut(s) 166, 263, 535, 736
Hin6I GCGC 1 cut(s) 315
HinP1I GCGC 1 cut(s) 315
HinfI GANTC 6 cut(s) 92, 475, 494, 508, 523, 679
HpaII CCGG 1 cut(s) 462
Hpy188I TCNGA 1 cut(s) 630
Hpy188III TCNNGA 3 cut(s) 25, 676, 686
HpyAV CCTTC 2 cut(s) 635, 700
HpyCH4III ACNGT 1 cut(s) 391
HpyCH4IV ACGT 2 cut(s) 232, 756
HpyCH4V TGCA 8 cut(s) 6, 48, 259, 387, 401, 437, 535, 568
HpyF10VI GCNNNNNNNGC 4 cut(s) 371, 380, 407, 437
HpyF3I CTNAG 1 cut(s) 762
HpySE526I ACGT 2 cut(s) 232, 756
Hsp92II CATG 4 cut(s) 166, 263, 535, 736
HspAI GCGC 1 cut(s) 315
Ksp22I TGATCA 2 cut(s) 237, 262
Kzo9I GATC 6 cut(s) 29, 205, 216, 237, 262, 672
LmnI GCTCC 3 cut(s) 244, 418, 688
Lsp1109I GCAGC 5 cut(s) 202, 358, 385, 397, 449
MaeI CTAG 2 cut(s) 428, 458
MaeII ACGT 2 cut(s) 232, 756
MaeIII GTNAC 2 cut(s) 226, 340
MalI GATC 6 cut(s) 31, 207, 218, 239, 264, 674
MboI GATC 6 cut(s) 29, 205, 216, 237, 262, 672
MboII GAAGA 3 cut(s) 143, 263, 662
MfeI CAATTG 1 cut(s) 266
MhlI GDGCHC 2 cut(s) 313, 693
MluCI AATT 6 cut(s) 74, 266, 377, 543, 639, 700
MlyI GAGTC 3 cut(s) 101, 469, 688
MnlI CCTC 9 cut(s) 52, 98, 137, 159, 172, 327, 575, 637, 693
Mph1103I ATGCAT 1 cut(s) 261
MseI TTAA 4 cut(s) 68, 120, 489, 696
MslI CAYNNNNRTG 1 cut(s) 392
MspA1I CMGCKG 1 cut(s) 440
MspCI CTTAAG 1 cut(s) 119
MspI CCGG 1 cut(s) 462
MspR9I CCNGG 1 cut(s) 291
MunI CAATTG 1 cut(s) 266
MvaI CCWGG 1 cut(s) 291
MvnI CGCG 2 cut(s) 315, 528
MwoI GCNNNNNNNGC 4 cut(s) 371, 380, 407, 437
NdeII GATC 6 cut(s) 29, 205, 216, 237, 262, 672
NlaIII CATG 4 cut(s) 166, 263, 535, 736
NmuCI GTSAC 1 cut(s) 340
NsiI ATGCAT 1 cut(s) 261
PaeR7I CTCGAG 1 cut(s) 89
PfeI GAWTC 3 cut(s) 494, 508, 523
PkrI GCNGC 5 cut(s) 192, 373, 400, 412, 439
PleI GAGTC 3 cut(s) 100, 469, 687
PpsI GAGTC 3 cut(s) 100, 469, 687
Psp6I CCWGG 1 cut(s) 289
PspGI CCWGG 1 cut(s) 289
PspPI GGNCC 1 cut(s) 622
PspXI VCTCGAGB 1 cut(s) 89
PstI CTGCAG 1 cut(s) 403
PvuII CAGCTG 1 cut(s) 440
RseI CAYNNNNRTG 1 cut(s) 392
SaqAI TTAA 4 cut(s) 68, 120, 489, 696
SatI GCNGC 5 cut(s) 191, 372, 399, 411, 438
Sau3AI GATC 6 cut(s) 29, 205, 216, 237, 262, 672
Sau96I GGNCC 1 cut(s) 622
SchI GAGTC 3 cut(s) 101, 469, 688
ScrFI CCNGG 1 cut(s) 291
SduI GDGCHC 2 cut(s) 313, 693
SfcI CTRYAG 1 cut(s) 399
Sfr274I CTCGAG 1 cut(s) 89
SinI GGWCC 1 cut(s) 622
SlaI CTCGAG 1 cut(s) 89
SmiMI CAYNNNNRTG 1 cut(s) 392
SmlI CTYRAG 2 cut(s) 89, 119
SmoI CTYRAG 2 cut(s) 89, 119
Sse9I AATT 6 cut(s) 74, 266, 377, 543, 639, 700
SspI AATATT 1 cut(s) 172
SspMI CTAG 2 cut(s) 428, 458
StyD4I CCNGG 1 cut(s) 289
TaaI ACNGT 1 cut(s) 391
TaiI ACGT 2 cut(s) 235, 759
TaqI TCGA 3 cut(s) 90, 219, 675
TasI AATT 6 cut(s) 74, 266, 377, 543, 639, 700
TfiI GAWTC 3 cut(s) 494, 508, 523
Tru1I TTAA 4 cut(s) 68, 120, 489, 696
Tru9I TTAA 4 cut(s) 68, 120, 489, 696
TscAI CASTG 1 cut(s) 476
TseFI GTSAC 1 cut(s) 340
TseI GCWGC 5 cut(s) 190, 371, 398, 410, 437
Tsp45I GTSAC 1 cut(s) 340
TspDTI ATGAA 2 cut(s) 346, 680
TspRI CASTG 1 cut(s) 476
Vha464I CTTAAG 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 622
XapI RAATTY 1 cut(s) 377
XhoI CTCGAG 1 cut(s) 89
XspI CTAG 2 cut(s) 428, 458
Zsp2I ATGCAT 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.